Реестр результатов интеллектуальной деятельности (раздел 3)
Федеральный каталог высокотехнологичного оборудования и объектов научного потенциала России

Реестр результатов интеллектуальной деятельности (раздел 3)

 1.  Грузовой автомобиль с приводом всех колес
 2.  Энергетическая установка для снабжения электрической и тепловой энергией хозяйственных и социальных объектов
 3.  Энергетическая установка для получения электрической и тепловой энергии
 4.  Устройство термостатирования аккумуляторных батарей
 5.  Система управления межосевым дифференциалом с тремя планетарными рядами
 6.  Грузовой автомобиль с передними и задними ведущими колесами
 7.  Устройство управления межосевым дифференциалом с тремя планетарными рядами
 8.  Грузовой автомобиль с передним и задним ведущими мостами
 9.  Проходной ведущий мост колесной тележки транспортного средства
 10.  Полноприводный грузовой автомобиль
 11.  Трансмиссия полноприводного грузового автомобиля
 12.  Грузовой автомобиль со всеми ведущими колесами
 13.  Трансмиссия полноприводного автомобиля
 14.  Комбинированная энергетическая установка транспортного средства
 15.  Раздаточная коробка полноприводного автомобиля
 16.  Трансмиссия полноприводного грузового автомобиля
 17.  Раздаточная коробка
 18.  Межосевой дифференциал полноприводного автомобиля
 19.  Буферный накопитель энергии комбинированной энергетической установки автобуса
 20.  База данных по единичным процессам в полном жизненном цикле колесных ТС
 21.  Программное обеспечение по оценке энергетических, экологических и экономических показателей колесных ТС, их компонентов и технологий в ПЖЦ
 22.  Устройство для подачи топлива к форсунке теплового двигателя
 23.  Устройство для подачи топлива к форсунке дизельного двигателя
 24.  Усилитель давления топлива в форсунке двигателя внутреннего сгорания
 25.  Устройство для подачи топлива к форсунке двигателя внутреннего сгорания
 26.  Комбинированный преобразователь энергии волн
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 27.  Способ включения трансформатора тяговой подстанции
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 28.  Устройство для испытания трубной заготовки
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 29.  Устройство измерения температуры инструмента в процессе резания
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 30.  Устройство для обжима продольной заготовки по всей длине
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 31.  Аварийно-сигнальный буй Овчинникова
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 32.  Предварительно-напряженная ферма оболочечного типа из легких стольных тонкостенных конструкций (ЛСТК)
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 33.  Инструмент для обработки отверстий
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 34.  Цистерна для транспортировки загустевающих жидкостей
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 35.  Устройство скрайбирования
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 36.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 37.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 38.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 39.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 40.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 41.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 42.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 43.  Устройство для удаления гололеда с провода линии электропередач
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 44.  Пластина колёсотокарная чашечная со стружколомающим рельефом передней поверхности
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 45.  Теплогенерирующий электромеханический преобразователь
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 46.  Преобразователь энергии перепада температур с жидкометаллическим электродом
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 47.  Устройство для уплотнения грузовых трюмов безлюковых контейнеровозов
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 48.  Система частотно-регулируемых электроприводов для комплекса грузоподъемных кранов
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 49.  Конструкция для сбора воды от увлажнения бетона при монолитном бетонировании строительных контсрукций
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 50.  Способ разрушения ледяного покрова
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 51.  Металлорежущий станок с регулируемой зоной доступа
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 52.  Преобразователь энергии перепада температур с электродом из жидкого диэлектрика с высоким значением диэлектрической проницаемости
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 53.  Источник питания дуговой сварки
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 54.  Штамп для формовки листовых заготовок давлением замораживаемой воды
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 55.  Способ включения трехфазных нагрузок
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 56.  Способ регулирования трехфазного синусоидального напряжения
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 57.  Интеллектуальная изоляционная система
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 58.  Эластичная матрица для штамповки листовых заготовок
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 59.  Способ снижения расхода топлива на котельных
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 60.  Предварительно-напряженная ферма из легких стальных тонкостенных конструкций (ЛСТК)
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 61.  Электромеханический преобразователь
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 62.  Способ направленного обмена энергией между электрическими сетями коммунального хозяйства и городского электрифицированного транспорта
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 63.  Газомагнитный подшипниковый узел с поперечным расположением магнитопроводов
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 64.  Система 150-градусного управления ведомым инвертором напряжения с широтно-импульсной модуляцией
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 65.  Устройство для выгрузки нефтяного кокса из аппарата
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 66.  Способ термической обработки стали
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 67.  Смесь для изготовления огнеупорных бетонов
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 68.  Стержневая смесь со связующим на основе сульфата магния
681013, г. Комсомольск-на-Амуре, пр. Ленина, 27; Тел. : (4217) 53-23-04; E-mail: nis@knastu.ru
 69.  Способ регулирования двигателя внутреннего сгорания
 70.  Устройство привода клапана двигателя
 71.  Стенд для исследования автомобильной шины
 72.  Способ исследования автомобильной шины
 73.  Дифференциальный механизм
 74.  Раздаточная коробка колесной машины
 75.  Комбинированный четырехцилиндровый двигатель
 76.  Способ работы поршневого двигателя
 77.  СПОСОБ ПРОГНОЗИРОВАНИЯ СКЛОННОСТИ ИСКОПАЕМЫХ УГЛЕЙ К САМОВОЗГОРАНИЮ И УСТРОЙСТВО ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ
Изобретение относится к области исследования материалов путем определения их теплофизических свойств и предназначено для прогнозирования в лабораторных условиях эндогенной пожароопасности угольных шахтопластов при геологоразведочных разработках. Технический результатом является создание модели, имитирующей природные процессы низкотемпературного гидротермального и флюидогенного преобразования углей в очагах самовозгорания шахтопластов. Для прогнозирования склонности ископаемых углей к самовозгоранию создают модель, имитирующую природные процессы гидротермального и флюидогенного преобразования углей в очагах самовозгорания шахтопластов. Осуществляют непрерывную проточную фильтрацию водно-воздушной смеси через измельченную пробу угля, помещенную в кварцевый реактор с заданным режимом нагревания до температуры не превышающей температуру самовозгорания угля. Затем охлаждают кварцевый реактор до комнатной температуры и повторяют непрерывную проточную фильтрацию. Фиксируют начало термодеструкции пробы по реакции индикаторного газа с водно-щелочным раствором. По углу расхождения кривых, соответствующих первому и повторному нагреванию на графике определяют скорость протекания экзотермической реакции. Вычисляют время инкубационного периода самовозгорания, которое является прогнозным фактором склонности ископаемых углей к самовозгоранию. 2 н. и 8 з. п. ф-лы, 5 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 78.  СПОСОБ ПРОФИЛАКТИКИ ГЕМАТОГЕННОГО МЕТАСТАЗИРОВАНИЯ
Изобретение относится к медицине и может быть применимо для профилактики гематогенного метастазирования опухолей желудочно-кишечного тракта. Размещают стерильную самоклеящуюся повязку размером 6× 4 см клеящейся стороной вверх под гепатодуоденальную связку. Укладывают стерильную силиконовую трубку длиной 1 метр одним концом на повязку не менее чем на 2 сантиметра от края, другой конец трубки соединяют со шприцем инфузомата, повязку сворачивают над гепатодуоденальной связкой, склеивая свободные края так, чтобы трубка размещалась внутри повязки. В ходе ревизии, мобилизации и удаления опухоли подают по трубке посредством инфузомата раствор химиопрепарата внутрь повязки. Воздействуют на повязку ультразвуковым инструментом режимом 880 Гц, 0, 4 Вт/ м2 в течение мобилизации сосудов и удаления опухоли. Способ позволяет уменьшить риск метастазирования. 1 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 79.  АКУСТООПТИЧЕСКИЙ СПЕКТРОАНАЛИЗАТОР
Изобретение относится к радиоизмерительной технике и может быть использовано в качестве широкополосного измерителя частоты радиосигналов. Технический результат, заключающийся в расширении полосы рабочих частот, достигается тем, что в акустооптический спектроанализатор, содержащий в своем составе лазер, коллиматор, акустооптический дефлектор, глухое зеркало, две интегрирующие линзы и две линейки фотоприемных устройств, в котором измеряемый радиосигнал подается на пьезопреобразователь акустооптического дефлектора, а на одну из его оптических граней лазерное излучение падает под отрицательным углом Брэгга и дифрагирует по направлению последовательно расположенных первой интегрирующей линзы и первой линейки фотоприемных устройств, а на вторую оптическую грань акустооптического дефлектора лазерное излучение, переотражаясь от глухого зеркала, падает под положительным углом Брэгга и дифрагирует по направлению последовательно расположенных второй интегрирующей линзы и второй линейки фотоприемных устройств, дополнительно между первой и второй гранями акустооптического дефлектора и первой и второй интегрирующими линзами включены первый и второй поляроиды, а акустооптический дефлектор выполнен на основе ниобата лития с косым углом среза, равным , и аномальной дифракцией, характеризуемой наличием двух одинаковых полос пропускания f 1 и f 2 вблизи отличающихся частот перегиба f01 и f02, задаваемых соответствующей величиной угла , и между собой взаимосвязанных посредством f02 -f01 f 1 f 2, причем протяженность по свету пьезопреобразователя акустооптического дефлектора выбрана из условия совмещения полос f 1 и f 2 по заданному уровню неравномерности дифракционной эффективности. 4 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 80.  ОПТИЧЕСКОЕ ИНТЕРФЕРЕНЦИОННОЕ УСТРОЙСТВО ДЛЯ ИЗМЕРЕНИЯ ПЕРЕМЕЩЕНИЙ ПОВЕРХНОСТЕЙ ОБЪЕКТОВ КОНТРОЛЯ
Устройство содержит закрепленное на основании (1) устройство (2) для регулировки и фиксации его положения относительно поверхности (12) объекта (13), соединенный с ним цилиндрический корпус (4), во внутренней полости (5) которого установлены источник (6) когерентного оптического излучения и фокусирующая излучение (31) на поверхность (12) объекта (13) оптическая система (8) с устройствами для регулировки и фиксации их положения (7) и (9), опорную балку (14), выполненную составной из однотипных цилиндрических элементов (28), светонепроницаемый защитный корпус (19) с окном (20), установленный с возможностью перемещения вдоль опорной балки (14), во внутренней полости (21) которого установлены светоделитель (22) и отражатель (23), жестко скрепленные между собой, и экран с устройствами для регулировки и фиксации их положения (24) и (26). На концах цилиндрического корпуса (4) и опорной балки (14), обращенных к поверхности (12) объекта (13), установлен поворотный шарнир (10), а между ними установлено устройство для регулировки и фиксации положения (30) опорной балки (14) относительно цилиндрического корпуса (4). Технический результат - снижение трудоемкости подготовки к проведению измерений и повышение точности результатов измерений. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 81.  ПРОИЗВОДНЫЕ 1-(2-АРИЛОКСИЭТИЛ)- И 1-БЕНЗИЛЗАМЕЩЕННЫХ 3-(2-ГИДРОКСИЭТИЛ)-2-ИМИНОБЕНЗИМИДАЗОЛИНА, ОБЛАДАЮЩИЕ АНТИБАКТЕРИАЛЬНОЙ И ПРОТИСТОЦИДНОЙ АКТИВНОСТЬЮ
Настоящее изобретение относится к средству, обладающему антибактериальной и протистоцидной активностью, на основе гидрохлорида формулы (1а-л) , где R=C6H5OCH2 (a); 4-CH3C6H4OCH2 (б); 4-OCH3C6H4OCH2 (в); 2-OCH3C6H4OCH2 (г); 4-FC6H4OCH2 (д); 2-ClC6 H4OCH2 (e); C10H7 OCH2 (ж); 2, 4-Cl2C6H3 OCH2 (з); 4-BrC6H4OCH2 (и); 2-FC6H4 (к); 2-ClC6H 4 (л). Технический результат: получено новое средство, обладающие антибактериальной и протистоцидной активностью, в частности, в отношении бактерий Staphylococcus aureus, Escherichia coli и умеренную простоцидную активность в отношении простейших Colpoda steinii. 1 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 82.  1-ОМЕГА-АРИЛОКСИАЛКИЛ- И 1-БЕНЗИЛЗАМЕЩЕННЫЕ 2-ИМИНОБЕНЗИМИДАЗОЛИНЫ И ИХ ФАРМАКОЛОГИЧЕСКИ ПРИЕМЛЕМЫЕ СОЛИ, ОБЛАДАЮЩИЕ ПРОТИСТОЦИДНОЙ И АНТИМИКРОБНОЙ АКТИВНОСТЬЮ
Настоящее изобретение относится к новым 1- -арилоксиалкил- и бензилзамещенным 2-иминобензимидазолинам и их фармакологически приемлемым солям общей формулы 1, где R = СН=СН2, R1 = 2-ClC6H4 OCH2 (1б); R = СН=СН2, R1 = 4-ClC6H4OCH2 (1в); R = СН=СН 2, R1 = 4-BrC6H4OCH 2 (1г); R = СН=СН2, R1 = 2, 4-Cl 2C6H3OCH2 (1д); R = СН=СН 2, R1 = 3, 4-Cl2C6H 3 (1e); R = СН=СН2, R1 = 4-FC 6H4OCH2CH2 (1ж); R = CH 2N(C2H5)2, R1 = 4-C(CH3)3С6Н4ОСН 2 (1з); R = CH2N(C2H5) 2, R1 = 3, 4-Cl2C6H 3 (1к); R = R1 = 4-ОСН3С6 Н4ОСН2 (1л); R = 4-BrC6H 4, R1 = 4-ОСН3С6Н 4ОСН2 (1м); R = 4-BrC6H4 , R1 =2-ОСН3С6Н4ОСН 2 (1н); R = 4-NO2C6H4, R1 = 4-ОСН3С6Н4ОСН 2 (1o); R = 3, 4-Cl2C6H3 , R1 = 2-ОСН3С6Н4 ОСН2 (1п); R = 3, 4-Cl2C6H 3, R1 = 4-ОСН3С6Н 4ОСН2 (1p); R = С6Н5ОСН 2, R1 = 4-ОСН3С6Н 4ОСН2 (1c); R = 2-СН3С6 Н4ОСН2, R1 = 2-ОСН3 С6Н4ОСН2 (1т); R = 4-СН 3С6Н4ОСН2, R1 = 2-OCH3C6H4OCH2 (1у); R = 4-С(СН3)3C6H4OCH 2, R1 = 2-OCH3C6H 4OCH2 (1ф); R = 2-OCH3C6 H4OCH2, R1 = 4-BrC6 H4OCH2 (1х), обладающим протистоцидной и антибактериальной активностью. Технический результат: получены новые соединения, обладающие полезной биологической активностью. 1 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 83.  СПОСОБ ПОЛУЧЕНИЯ ПОРОШКОВ ФАЗ КИСЛОРОДНО-ОКТАЭДРИЧЕСКОГО ТИПА, СОДЕРЖАЩИХ ИОНЫ СВИНЦА (II) В ПОЗИЦИИ (А)
Изобретение может быть использовано в полупроводниковой, пьезоэлектрической и радиоэлектронной технике. Для получения порошков титаната, или цирконата, или ниобата свинца, или титаната-цирконата свинца из 0, 1-0, 3М растворов нитратных комплексов титана, циркония или ниобия при рН=8± 0, 5 осаждают с помощью 5-10% раствора аммиака при температуре ниже 280 К гидроксиды титана, циркония, ниобия или смешанный гидроксид титана-циркония. Полученные гидроксиды смешивают при температуре ниже 280 К с водной суспензией оксида свинца (II), затем оставляют на 10-20 минут. После этого проводят последовательную термообработку при температуре приблизительно 370 К в течение 50-60 минут, затем в изотермических условиях 20-30 минут. Изобретение позволяет снизить температуру синтеза и повысить пьезопараметры получаемых материалов. 3 ил. , 2 табл. , 15 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 84.  СПОСОБ МОДИФИЦИРОВАНИЯ ПОВЕРХНОСТИ ТИТАНА
Изобретение относится к области гальванотехники и может быть использовано в промышленности для формирования тонких слоев защитно-декоративных покрытий нитрида титана на поверхностях из титана и его сплавов. Способ электролитического формирования слоя нитрида титана на поверхности титана и его сплава включает анодную поляризацию изделия при постоянном токе в электролите на основе полярных органических растворителей в присутствии воды и 0, 1-0, 3 мас. % соли аммония в качестве электролитической добавки, при этом электролиз проводят при комнатной температуре электролита. Технический результат: получение тонких, плотных и равномерных слоев нитрида титана различной толщины на деталях различной конфигурации. 8 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 85.  ПРЕОБРАЗОВАТЕЛЬ ПУТИ И ЛИНЕЙНОЙ СКОРОСТИ ДВИЖЕНИЯ ОБЪЕКТА В КОД
Изобретение относится к измерительной технике, представляет собой преобразователь пути и линейной скорости движения объекта в код и может использоваться при контроле положения и скорости при малых (0, 1 мкм÷ 10 мкм) и больших (до 10 см) перемещениях. Для улучшения метрологических и весогабаритных характеристик преобразователя пути и линейной скорости электрический и магнитный блоки преобразователя реализованы на базе техники цилиндрических магнитных доменов (ЦМД) и микроэлектронного конструирования. Технический результат достигается тем, что с помощью магнитных триггеров 10 и 17, магнитного барьера 19 и электронного блока реверс 20, который осуществляет переключение фаз тактирующего генератора 1, проводится измерение пути и скорости объекта независимо от направления его движения, результаты которого регистрируются в счётчиках. Пределы измерения ограничиваются скоростью движения ЦМД (20 м/ с и более). При этом благодаря малым размерам ЦМД (0, 1 мкм÷ 10 мкм) значительно уменьшаются весогабаритные параметры преобразователей. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 86.  РАДИОЛОКАЦИОННЫЙ УРОВНЕМЕР
Радиолокационный уровнемер относится к радиотехнике и может быть использован для построения высокоточных измерителей уровня жидкостей или сыпучих веществ в резервуарах и высотомеров малых высот. Радиолокационный уровнемер содержит высокостабильный генератор 1, делители 2 и 3 частоты, контроллер 4, генератор 5 пилообразного напряжения, модулятор 6, приемно-передающий модуль 7, направленный ответвитель 8, антенну 9, узкополосные фильтры 10, 11 и 12, усилители-формирователи 13 и 14, смесители 15 и 16 и фильтр 17 разностной частоты. Технический результат - повышение точности измерений. 2 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 87.  СРЕДСТВО, ИНГИБИРУЮЩЕЕ Na / H -ОБМЕН, И ДИГИДРОХЛОРИД 2-(3, 4-МЕТИЛЕНДИОКСИФЕНИЛ)-9-МОРФОЛИНОЭТИЛИМИДАЗО[1, 2-a]БЕНЗИМИДАЗОЛА
Изобретение относится к фармацевтической промышленности, а именно относится к средствам, обладающим способностью ингибировать Na / H -обмен (NHE-обменники, ингибиторы NHE). Благодаря использованию изобретения осуществляется повышение эффективности ингибиторов Na / H -обмена (ингибитора NHE). 2 н. и 1 з. п. ф-лы, 1 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 88.  Средство, ингибирующее na / h -обмен, и галогениды 1-диалкил-аминоэтил-3-[замещенный (дизамещенный) фенацил]-2-амино-бензимидазолия
Изобретение относится к области фармацевтики и медицины и касается применения галогенидов 1, 3-дизамещенных 2-амино-бензимидазолия, общей формулы I в качестве ингибиторов Na / H -обмена, а также новых галогенидов 1, 3-дизамещенных 2-амино-бензимидазолия. Техническим результатом является повышение эффективности ингибиторов Na / H -обмена.
email: inno@sfedu.ru, тел. : (863) 218-40-90
 89.  РЕЦИРКУЛЯЦИОННЫЙ РАДИОВЫСОТОМЕР
Изобретение относится к радиолокационной технике и может быть использовано при разработке бортовых средств измерения высоты полета летательных аппаратов. Рециркуляционный радиовысотомер содержит генератор старт-импульсов, генератор тактовых импульсов, два элемента И, два элемента ИЛИ, три линии задержки, передатчик, направленный ответвитель, развязывающий блок, антенный блок, амплитудный детектор, СВЧ-выключатель, триггер, приемник, следящий блок и блок расчета высоты, определенным образом соединенные между собой. Достигаемый технический результат - упрощение радиовысотомера и повышение его надежности, а также расширение функциональных возможностей за счет обеспечения возможности текущего контроля точности измерения. 3 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 90.  ИМПУЛЬСНЫЙ РАДИОВЫСОТОМЕР
Изобретение относится к радиолокационной технике и может быть использовано для измерения высоты полета летательного аппарата при малых и сверхмалых высотах его полета. Достигаемый технический результат - упрощение радиовысотомера, повышение его надежности и помехозащищенности и расширение диапазона измеряемых высот. Указанный результат достигается за счет того, что импульсный радиовысотомер содержит передатчик, приемник, измеритель задержки, управляемый аттенюатор, передающую антенну, приемную антенну и блок управления, контроля и вычисления результатов измерений, определенным образом соединенные между собой. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 91.  РАДИОВЫСОТОМЕР С ЧАСТОТНО-МОДУЛИРОВАННЫМ ЗОНДИРУЮЩИМ СИГНАЛОМ
Изобретение относится к радиолокации, а именно к радиовысотомерам с частотной модуляцией зондирующего сигнала. Достигаемый технический результат - упрощение устройства и повышение его надежности и помехозащищенности. Указанный результат достигается за счет того, что радиовысотомер с частотно-модулированным зондирующим сигналом содержит приемную антенну, смеситель, усилитель разностной частоты с автоматической регулировкой усиления, частотный дискриминатор, блок цифрового управления скоростью перестройки частоты передатчика, модулятор, передатчик частотно-модулированного сигнала и передающую антенну, генератор тактовых импульсов и блок контроля, управления и расчета высоты, определенным образом соединенные между собой. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 92.  ИНТЕГРАЛЬНЫЙ ИНЖЕКЦИОННЫЙ ЛАЗЕР С МОДУЛЯЦИЕЙ ЧАСТОТЫ ИЗЛУЧЕНИЯ ПОСРЕДСТВОМ УПРАВЛЯЕМОЙ ПЕРЕДИСЛОКАЦИИ МАКСИМУМА АМПЛИТУДЫ ВОЛНОВЫХ ФУНКЦИЙ НОСИТЕЛЕЙ ЗАРЯДА
Изобретение относится к квантовой электронной технике. В интегральный инжекционный лазер введены верхняя управляющая область второго типа проводимости, примыкающая к верхнему волноводному слою, нижняя управляющая область второго типа проводимости, примыкающая к нижнему волноводному слою, нижняя управляющая область первого типа проводимости, примыкающая сверху к подложке, а снизу - к нижней управляющей области второго типа проводимости и образующая с ней p-n-переход, омический контакт к нижней управляющей области первого типа проводимости, управляющий металлический контакт, примыкающий сверху к верхней управляющей области второго типа проводимости и образующий с ней переход Шоттки. Нижняя граница зоны проводимости нижнего волноводного слоя находится ниже нижней границы зоны проводимости квантоворазмерной активной области и при этом выше нижней границы зоны проводимости верхнего волноводного слоя. Верхняя граница валентной зоны нижнего волноводного слоя находится ниже верхней границы валентной зоны активной области и при этом выше верхней границы валентной зоны верхнего волноводного слоя. Технический результат заключается в обеспечении возможности увеличения быстродействия устройства. 3 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 93.  РАСПРЕДЕЛЕННЫЙ СЕНСОР ТРЕЩИН, СПОСОБ РЕГИСТРАЦИИ ИХ ВОЗНИКНОВЕНИЯ И ОПРЕДЕЛЕНИЯ ЛОКАЛИЗАЦИИ
Изобретение относится к области диагностики механического состояния конструкций, а именно к технике диагностики повреждения поверхности конструкций, и может быть использовано для мониторинга поверхностей объектов авиационной техники. Распределенный сенсор трещин состоит из электрических проводников первой группы и электрических проводников второй группы, изолированных друг от друга, от материала объекта и внешней среды, причем проводники одной группы не пересекаются. Проводники первой группы пересекаются с каждым проводником второй группы в одной точке под углом , преимущественно равным 90° . Проводники одной группы отстоят друг от друга на расстоянии h, равном для обеих групп. При этом в сенсор трещин согласно изобретению введены бескорпусные двухэлектродные симисторы, располагающиеся в узлах пересечения электрических проводников первой группы и электрических проводников второй группы и соединенные первыми электродами с электрическими проводниками первой группы, а вторыми электродами с электрическими проводниками второй группы, при этом электрические проводники выполнены тонкопленочными, и слои тонкопленочного диэлектрика, расположенные таким образом, что тонкопленочные проводники находятся между двумя слоями тонкопленочного диэлектрика. Также предложен способ регистрации возникновения и определения локализации трещин. 2 н. п. ф-лы, 3 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 94.  СПОСОБ ИЗМЕРЕНИЯ ЧАСТОТЫ РАДИОСИГНАЛА В АКУСТООПТИЧЕСКОМ ПРИЕМНИКЕ-ЧАСТОТОМЕРЕ
Изобретение относится к радиоизмерительной технике. Способ определения частоты радиосигнала в акустооптическом приемнике-частотомере, заключающийся в подаче на электрический вход акустооптического дефлектора анализируемого радиосигнала, преобразовании его в акустический и далее в оптический сигнал, Фурье-преобразовании последнего с фиксацией распределения его интенсивности N-элементной линейкой фотодиодов, формировании на их выходах видеосигналов с уровнями, пропорциональными уровням упомянутого распределения интенсивности, вычислении частоты радиосигнала, отождествляемой с абсциссой оси симметрии распределения интенсивности светового сигнала, дискретизированного фотодиодами, подаче на вход дефлектора наряду с анализируемым и эталонных сигналов, нахождении в линейке фотодиодов, откликнувшихся на эти сигналы, нахождении среди откликов сигналов максимального уровня, регистрации номеров соответствующих им фотодиодов и измерении уровней сигналов и на них, и на рядом стоящих с ними фотодиодах, использовании этих данных для вычисления частот, соответствующих номерам фотодиодов с сигналами максимального уровня, выполнении перечисленных действий над откликами фотодиодов для R (где R> 2) эталонных сигналов, у которых частоты F 1, F2, , Fj, , FR равномерно распределены в частотном диапазоне частотомера и растут вместе с индексом, обозначении найденных номеров фотодиодов с сигналами максимального уровня nj (где (1 j R), обозначении уровней сигналов на них и на соседних с ними фотодиодах Ynj, Ynj 1, Ynj-1 соответственно, вычислении коэффициентов knj, вычислении частотных интервалов Fj в полосах частот fj fj 1, где частоты fj=Fj -knj Fj соответствуют фотодиодам с номерами n j, последующем определении соответствующих q-тым (где n j q nj 1) фотодиодам частот fq=f j Fj-(q-nj), используемых для вычисления абсциссы упомянутой оси симметрии. Технический результат заключается в увеличении точности измерения частоты радиосигнала.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 95.  СРЕДСТВО, ОБЛАДАЮЩЕЕ КАРДИОТОНИЧЕСКОЙ АКТИВНОСТЬЮ
Изобретение относится к фармакологии, а именно к применению бромида 2-бензил-1-морфолиноэтил-3-пивалоилметилбензимидазолия формулы I в качестве кардиотонического активного соединения, в том числе для изготовления кардиотонического средства. Заявленное изобретение обеспечивает повышение кардиотонической активности. 1 з. п. ф-лы, 6 ил. , 5 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 96.  ЭХОЛОТ
Использование: изобретение относится к гидроакустическим системам определения глубины и к системам навигации и может быть использовано в эхолотах с автоматическим адаптивным обнаружением эхо-сигналов от дна и измерением глубины с привязкой к географическим координатам места измерения. Сущность: эхолот содержит ЭВМ 1, усилитель 2 мощности, приемник 3 акустических эхо-сигналов, приемник 4 сигналов спутниковых радионавигационных систем, переключатель 5 прием-передача, электроакустический преобразователь 6, аналого-цифровой преобразователь 7 и дисплей 8. Первый вход ЭВМ 1 соединен с выходом преобразователя 7, а второй - с выходом приемника 4. Первый выход ЭВМ 1 соединен с входом дисплея 8, второй - с входом управления приемника 3, третий - с входом усилителя 2, а четвертый - с управляющим входом переключателя 5. Сигнальный вход переключателя 5 соединен с выходом усилителя 2, вход-выход - с входом-выходом преобразователя 6, а выход - с сигнальным входом приемника 3, выход которого соединен с входом преобразователя 7. Технический результат: повышение помехозащищенности и надежности эхолота, расширение его функциональных возможностей. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 97.  УСТРОЙСТВО ДЛЯ ИЗМЕРЕНИЯ ПАРАМЕТРОВ МОРСКИХ ВОЛН
Изобретение относится к измерительной технике и может быть использовано в метеорологии, навигации, океанографических исследованиях, мореходных испытаниях судов и гидросамолетов для оценки силы волнения морских волн, в автоматизированных системах посадки самолетов-амфибий на водную поверхность в ночное и дневное время. Устройство содержит последовательно включенные антенну 1, приемопередатчик 2, усилитель 3 доплеровского сигнала, аналого-цифровой преобразователь 4 и вычислитель 5, второй вход которого соединен с входом 6 устройства, а первый выход - с управляющим входом приемопередатчика. Кроме того, устройство оснащено индикатором (дисплеем) 7, вход которого соединен со вторым выходом вычислителя 5. Технический результат: сокращение аппаратурной части, упрощение, повышение надежности, повышение быстродействия и точности расчета. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 98.  СПОСОБ ИДЕНТИФИКАЦИИ СТЕРИЛЬНОСТИ/ ФЕРТИЛЬНОСТИ ПОДСОЛНЕЧНИКА
Изобретение относится к области биохимии, в частности к способу молекулярно-генетической идентификации стерильности/ фертильности пыльцы подсолнечника. Способ включает анализ тотальной ДНК исследуемых образцов на наличие/ отсутствие митохондриального гена orfH522 и маркерной последовательности ядерного гена Rf1 с помощью мультиплексной полимеразной цепной реакции с использованием первой пары праймеров: agtagcccgttccgtgtttatgga и ctttctatttgggtcatcgccgga, идентифицирующей ген orfH522 цитоплазматической мужской стерильности пыльцы (ЦМС РЕТ1), и второй пары праймеров: ggcatgatcaagtacataagcacagtc и tatgtacgggaatgagctccggtt, идентифицирующей маркерную последовательность гена Rf1 - восстановителя фертильности пыльцы ЦМС РЕТ1, при этом образец определяют как фертильный, если а) присутствует и orfH522, и маркер гена Rf1, б) отсутствует orfH522 и присутствует маркер гена Rf1, в) отсутствует и orfH522, и маркер гена Rf1, и образец определяют как стерильный, если присутствует orfH522 и отсутствует маркер гена Rf1. Раскрыт диагностический набор, включающий праймеры, для молекулярно-генетической идентификации стерильности/ фертильности пыльцы подсолнечника указанным способом, а также применение указанного способа в селекции растений. Изобретение позволяет эффективно определять стерильность/ фертильность пыльцы подсолнечника. 3 н. и 4 з. п. ф-лы, 6 ил. , 1 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 99.  СРЕДСТВО, ОБЛАДАЮЩЕЕ КАРДИОПРОТЕКТОРНЫМ ДЕЙСТВИЕМ, И ГАЛОГЕНИДЫ 1, 3-ДИЗАМЕЩЕННЫХ 2-АМИНОБЕНЗИМИДАЗОЛИЯ
Изобретение относится к области фармацевтики и медицины и касается применения трициклических производных имидазо[1, 2-а]бензимидазола общей формулы I или галогенидов 1, 3-дизамещенных 2-аминобензимидазолия общей формулы II в качестве средства, обладающего кардиопротекторным действием с высокой эффективностью. 2 н. и 1 з. п. ф-лы, 1 табл. , 2 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 100.  ГИДРОАКУСТИЧЕСКИЙ КОМПЛЕКС
Изобретение относится к области гидроакустики и может быть использовано в качестве гидроакустического вооружения подводных лодок различного назначения, а также при проведении подводных геологических и гидроакустических работ и исследований. Комплекс включает в себя тракты основного и дополнительного шумопеленгования, тракт обнаружения гидроакустических сигналов, тракт гидролокации, тракт связи и опознавания, тракт миноискания и обнаружения навигационных препятствий, центральную вычислительную систему, систему отображения, регистрации, документирования и управления и общую шину. При этом все излучающие антенны тракта гидролокации выполнены электронно управляемыми как по числу лучей характеристики направленности, так и по их ширине и направлению. Тракт основного шумопеленгования содержит основную носовую приемную антенну и первое устройство предварительной обработки. Тракт обнаружения гидроакустических сигналов содержит три приемные антенны и второе устройство предварительной обработки. Тракт гидролокации содержит три электронно управляемые антенны и первое генераторное устройство. Тракт связи и опознавания содержит две излучающие антенны и второе генераторное устройство. Тракт миноискания и обнаружения навигационных препятствий содержит приемопередающую антенну, переключатель прием-передача, третье генераторное устройство и третье устройство предварительной обработки. Тракт дополнительного шумопеленгования содержит гибкую протяженную буксируемую антенну, кабель-трос, токосъемное устройство и четвертое устройство предварительной обработки. Технический результат: повышение скрытности работы ГАК и дальности обнаружения целей в режиме ГЛ. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 101.  УСТРОЙСТВО УПРАВЛЕНИЯ ПОДВИЖНЫМ ОБЪЕКТОМ
Изобретение относится к системам управления и может быть использовано при разработке систем управления подвижными объектами, обеспечивающих их перемещение по заданной траектории с заданной скоростью в неопределенных средах. Технический результат - уменьшение отклонения фактической траектории объекта управления от заданной, а значит, и сокращение затрат времени на реализацию заданной траектории. Устройство управления подвижным объектом содержит планировщик траектории, три вычислителя матричных коэффициентов, вычислитель сигнала управления, два блока транспонирования матриц, блок датчиков информации, блок сенсорного обеспечения, блок формирования вектора нелинейных элементов, блок формирования матрицы коэффициентов управления, блок формирования матрицы - производной вектор-столбца внешних скоростей по вектор-строке внутренних координат, блок формирования матрицы - производной вектор-столбца внешних скоростей по вектор-строке внешних координат, блок формирования вектора внешних скоростей, пороговое устройство, измеритель диапазона изменения угла визирования препятствия и расстояния до него, блок расчета поправки сигнала управления, сумматор, исполнительное устройство и механическую систему. 5 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 102.  СПОСОБ ПРИГОТОВЛЕНИЯ ШИХТЫ ДЛЯ ПОЛУЧЕНИЯ ПЬЕЗОКЕРАМИЧЕСКОГО МАТЕРИАЛА
Изобретение относится к технологии изготовления пьезокерамических материалов системы цирконата-титаната свинца (ЦТС) и может быть использовано в составе гидроакустических излучателей и гидрофонов. Технический результат - способ позволяет управлять значениями скорости звука в пьезокерамическом материале системы ЦТС при сохранении значений диэлектрических и пьезоэлектрических параметров. Готовят навески исходных компонентов для получения шихты состава, мас. %: PbO 54, 3, ZrO2 21, 19, TiO2 12, 18, SrCO3 0, 47, BaCO3 15, 37. Шихту измельчают в аттриторе в течение 2-12 часов. В качестве мелющих тел используют стальные шары диаметром 10-20 мм, при этом соотношение по массе количества исходной шихты, мелющих тел и дистиллированной воды составляет 1: 3: 1 соответственно, а время смешивания и измельчения выбирают из условия получения значений удельной поверхности порошка 4000-7000 см2/ г. Намол металлического железа легирует материал в позиции В, что позволяет управлять значениями скорости звука на стадии приготовления шихты. В систему попадает металлическое железо, которое переходит в оксид железа на этапе высокотемпературного синтеза. 6 з. п. ф-лы, 3 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 103.  СПОСОБ ПОЛУЧЕНИЯ 1, 2-ДИ(1Н-БЕНЗИМИДАЗОЛИЛ-2)-1, 3-ДИАЛКИЛГУАНИДИНОВ
Изобретение относится к способу получения 1, 2-ди(1H-бензимидазолил-2)-1, 3-диалкилгуанидинов общей формулы I, где R = алкил C1-C6, заключающемуся во взаимодействии 3-алкил-1, 2, 4-триазоло[1, 5-a]бензимидазола с бутилмагнийбромидом в апротонном растворителе в инертной атмосфере. Технический результат: разработан способ получения производных гуанидина формулы I, которые могут найти применение в медицине. 1 н. и 2 з. п. ф-лы. 2 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 104.  Цинковые и кадмиевые комплексы тетрадентатных азометинов 2-тозиламино-бензальдегида, обладающие люминесцентной активностью
Изобретение относится к новым металлохелатам, а именно к комплексам цинка и кадмия тетрадентатных азометинов 2-тозиламино-бензальдегида и диоксидиаминов формулы I. Металло-комплексные соединения I проявляют фото-люминесцентные свойства в синей области спектра и могут быть использованы в качестве электро-люминесцентого слоя при создании светоизлучающих органических диодов (OLED) белого и видимого света.
email: inno@sfedu.ru, тел. : (863) 218-40-90
 105.  СПОСОБ ИМПРЕГНИРОВАНИЯ АБРАЗИВНОГО ИНСТРУМЕНТА
Изобретение относится к области абразивной обработки и может быть использовано при производстве и эксплуатации абразивного инструмента на керамической связке. Осуществляют пропитку абразивного инструмента в емкости с водным раствором, содержащим 20-25 г дийодида хрома на литр воды, с обеспечением фиксации дийодида хрома в поровом пространстве инструмента при периодическом встряхивании емкости. Проводят конвективную сушку инструмента в течение 1, 5-2 часов при температуре 40-50° C. В результате увеличивается срок хранения абразивного инструмента. 2 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 106.  Цинковые комплексы 5-[2-гидрокси (тозиламино) бензилиденамино]-2-(2-тозиламино-фенил)-1-алкил-бензимидазолов, обладающие фото-люминесцентной активностью
Изобретение относится к цинковым комплексам 5- [2-гидрокси (тозиламино) бензилиденамино]-2-(2-тозиламинофенил)-1-алкил-бензимидазолов общей формулы. Соединения I проявляют люминесцентные свойства и могут быть использованы в качестве люминофоров для получения светоизлучающих органических диодов белого и видимого света.
email: inno@sfedu.ru, тел. : (863) 218-40-90
 107.  ШТАММ VIBRIO AQUAMARINUS, СПОСОБ ОПРЕДЕЛЕНИЯ ТОКСИЧНОСТИ ПРОБ С ЕГО ПОМОЩЬЮ И ТЕСТ-КУЛЬТУРА ДЛЯ ОПРЕДЕЛЕНИЯ ТОКСИЧНОСТИ ПРОБ
Группа изобретений относится к биотехнологии и может быть использована для биотестирования токсичности объектов окружающей среды. Заявлены штамм бактерий Vibrio aquamarinus, способ определения токсичности проб с его помощью и применение штамма в качестве тест- культуры для определения химической токсичности проб. Измеряют люминесценцию штамма Vibrio aquamarinus ВКПМ В-11245 в присутствии по меньшей мере одного химического токсиканта пробы, в качестве которого могут быть использованы ZnSO4 или CuSO4, или K2Cr2O7 , или нефть, или дизельное топливо, или льяльная вода, или фенол, или тяжелый металл. Измеряют люминесценцию указанного штамма при отсутствии химического токсиканта и сравнивают измеренные уровни люминесценции. При этом изменение люминесценции свидетельствует о токсичности исследуемой пробы. Изобретение позволяет повысить достоверность определения наличия токсических веществ в окружающей среде. 3 н. и 6 з. п. ф-лы, 4 табл. , 4 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 108.  СПОСОБ ДИАГНОСТИКИ ОКИСЛИТЕЛЬНОГО СТРЕССА ИЗМЕРЕНИЕМ ЭКСПРЕССИИ КИСЛОРОДЧУВСТВИТЕЛЬНЫХ ГЕНОВ (ВАРИАНТЫ)
Группа изобретений относится к области медицины и молекулярной биологии. Способ предусматривает измерение экспрессии следующих кислородчувствительных генов: Pdk4, Nid2, Golph2, Actr1a, Api5, Mrp13, Scn7a, Асох3, Lamr1, Sv2b, Stmn2, Тrрс3, Crebzf, Herс1, Ssc1, Snrpb, Zfhx1b, sc125b, Rn. 48050, Rn. 42485, MPP3, AI 101224, Abca1, Appbp1, Rn. 96234, Nptxr, Rn. 16755, Vamp2, Ghr, Calm1, Cyp51, и ID1, и по определенному различию в уровне экспрессии данных генов у животных, подвергнутых и не подвергнутых воздействию окислительного стресса, делают вывод о наличии окислительного стресса у млекопитающего. Способ позволяет диагностировать состояние окислительного стресса у организма как во время, так и после воздействия окислительного стресса. 2 н. и 4 з. п. ф-лы, 2 ил. , 2 табл. , 2 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 109.  СПОСОБ РАДИОЛОКАЦИОННОГО ИЗМЕРЕНИЯ РАССТОЯНИЯ
Изобретение может быть использовано для построения высотомеров или высокоточных измерителей уровня жидкостей или сыпучих веществ в резервуарах. Достигаемый технический результат - повышение точности измерения расстояния. Указанный результат заключается в том, что заявленный способ основан на излучении в направлении отражающей поверхности зондирующего СВЧ-сигнала с линейной частотной модуляцией, приеме в точке излучения отраженного сигнала, смешении принятого сигнала с зондирующим, формировании сигнала частоты биений зондирующего и отраженного сигналов, измерении этой частоты и определении по результатам измерения расстояния от точки излучения до отражающей поверхности как величины, пропорциональной измеренной частоте, измерении крутизны перестройки частоты зондирующего сигнала как функции времени, прошедшего от начала цикла перестройки, результат измерения записывают в оперативную память устройства, реализующего способ, а расстояние Н от точки излучения зондирующего сигнала до отражающей поверхности определяют из соотношения: , где Н - измеряемое расстояние; С-3· 108 м/ с - скорость света; Fб(t) и (t) - частота биений и крутизна перестройки частоты зондирующего сигнала как функции времени, отсчитываемого от начала цикла перестройки частоты. 2 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 110.  УСТРОЙСТВО ДЛЯ УПРАВЛЕНИЯ ПОДВОДНЫМ АППАРАТОМ
Изобретение относится к системам управления движением подводных аппаратов. Устройство содержит установленные на подводном аппарате (1) движители вертикального (2) и горизонтального (3) перемещений, телекамеру (4), выполненную с возможностью поворота, датчик (5) положения угла поворота телекамеры, первый (6), второй (7) и третий (8) нелинейные функциональные преобразователи, блок (9) управления движителями, датчик (10) расстояния, вручную коммутируемый ключ (11), пороговый элемент (12), электронно-управляемый переключатель (13). Повышается надежность и точность подхода подводного аппарата к обнаруженному объекту. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 111.  СПОСОБ УПРАВЛЕНИЯ ПОДВИЖНЫМ ОБЪЕКТОМ
Изобретение относится к системам управления и может быть использовано при разработке систем управления подвижными объектами, обеспечивающих их перемещение по заданной траектории с заданной скоростью в неопределенных средах. Техническим результатом является уменьшение отклонения фактической траектории объекта управления от заданной и сокращение затрат времени на реализацию заданной траектории. В известном способе управления подвижным объектом дополнительно измеряют диапазон изменения угла визирования ближайшего препятствия, неожиданно возникшего на пути следования объекта управления, обусловленный размерами этого препятствия и его угловыми флюктуациями, и в случае, если направление вектора внешней скорости объекта управления попадает в этот диапазон, изменяют его направление таким образом, чтобы оно вышло из диапазона за минимально возможное время.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 112.  СИСТЕМА УПРАВЛЕНИЯ ПОДВОДНЫМ АППАРАТОМ
Изобретение относится к системам управления и может быть использовано при разработке систем управления подводными аппаратами, обеспечивающими их ориентацию и перемещение по заданной траектории с заданной траекторией скоростью, или в заданную точку по требуемой траектории без предъявления требований к траекторией скорости, или в заданную точку с нулевой конечной скоростью. Технический результат заключается в обеспечении возможности управления движением подводного аппарата. Технический результат достигается за счет того, что в устройство управления подвижным объектом дополнительно введены судовой пункт управления, два приемопередатчика с антеннами, гидролокатор с антенной и блок пересчета координат, при этом объектом управления является подводный аппарат, большая часть оборудования установлена на судовом пункте управления. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 113.  УСТРОЙСТВО ДЛЯ ПОДОГРАФИИ
Изобретение относится к медицинской технике и предназначено для определения временных характеристик ходьбы или бега человека и животных. Возможно использование устройства в охранной сигнализации. Для повышения помехоустойчивости и снижения мощности излучения при бесконтактной регистрации биомеханических параметров в устройство, содержащее датчик опоры, выполненный в виде диэлектрического основания с нанесенным на обе горизонтальные поверхности диэлектрического основания сплошным проводящим покрытием, генератор и регистратор, введен детектор, подключенный к выходу генератора. 4 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 114.  СПОСОБ ПОДГОТОВКИ ВЗЛЕТНО-ПОСАДОЧНОЙ ПОЛОСЫ ЛЕТНОГО БАССЕЙНА ГИДРОАЭРОДРОМА ДЛЯ ВЫПОЛНЕНИЯ ВЗЛЕТА И ПРИВОДНЕНИЯ ГИДРОСАМОЛЕТА
Изобретение относится к области амфибийного транспорта и касается повышения безопасности взлетно-посадочных действий магистральных самолетов-амфибий. Во время подготовки летного бассейна гидроаэродрома определяют положение ВПП как с учетом направления ветра, так и из условия минимальности имеющейся на акватории ветровой волны. Экипаж СВП производит разметку ВПП посредством установки плавучих навигационных знаков: маркерных, курсового маяка, СВП как знака зоны приводнения. Визуально и с помощью радиолокатора и гидролокатора осматривает путь перемещения гидросамолета по акватории. На борту СВП размещает глиссадные и курсовые радиомаяки для посылки и приема радиосигналов. Операторы береговой гидроакустической службы осуществляют различные виды подводного мониторинга. На плавучих навигационных знаках и на береговых постройках гидроаэродрома размещают активные радиолокационные отражатели (АРЛО) с круговой диаграммой рассеяния в верхней полусфере, что обеспечивает переизлучение в обратном направлении достигших их сигналов посылки РЛС, которые усилены по мощности и когерентны зондирующему излучению, что приводит к увеличению собственной радиолокационной заметности объектов. Достигается получение уточненной информации о навигационном состоянии летного бассейна гидроаэродрома за счет многопозиционного радиолокационного мониторинга как с борта гидросамолета, так и с берегового поста службы обеспечения, повышение безопасности взлетно-посадочных действий на мелководной акватории. 3 з. п. ф-лы, 9 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 115.  КОМПЛЕКС РАДИОЭЛЕКТРОННОГО ПОДАВЛЕНИЯ СИСТЕМЫ РАДИОСВЯЗИ
Изобретение относится к радиотехнике, а именно к радиоэлектронному подавлению активными помехами радиоэлектронных средств, в частности средств радиосвязи с псевдослучайной перестройкой рабочей частоты, и может быть использовано для подавления корабельных и авиационных средств радиосвязи. Комплекс РЭП содержит приемник 4 сигналов спутниковых радионавигационных систем, определитель 5 координат носителей передатчика и приемника подавляемой системы, вычислитель 6, последовательно включенные приемную антенну 7, входной СВЧ-усилитель 8, СВЧ-разветвитель 9, амплитудный детектор 10 и блок 11 анализа зондирующего сигнала, блок 12 памяти, измеритель 13 несущей частоты, определитель 14 наличия фазовой манипуляции, формирователь 15 импульсов по переднему фронту и последовательно включенные формирователь 16 помех, СВЧ-коммутатор 17, усилитель 18 мощности и передающую антенну 19. При этом формирователь 16 помех содержит блок 20 прямого сдвига частоты, расширитель 21 радиоимпульса промежуточной частоты и блок 22 обратного сдвига частоты. 1 з. п. ф-лы, 3 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 116.  СПОСОБ РАДИОЭЛЕКТРОННОГО ПОДАВЛЕНИЯ СИСТЕМЫ РАДИОСВЯЗИ
Изобретение относится к радиотехнике и может быть использовано для подавления корабельных и авиационных средств радиосвязи. Технический результат - повышение эффективности радиоэлектронного подавления. Способ радиоэлектронного подавления системы радиосвязи основан на приёме зондирующего информационного сигнала подавляемой системы, воспроизведении его несущей частоты, формировании помехового сигнала, его усилении и излучении в направлении подавляемого средства. В способе непрерывно измеряют координаты носителей передатчика и приёмника подавляемой системы, в качестве носителя комплекса РЭП используют летательный аппарат, при этом удерживают этот носитель в точке пространства на линии передатчик - приёмник на минимально возможном расстоянии от приёмника, при обнаружении в принятом зондирующем информационном сигнале передатчика информационных радиоимпульсов фазоманипулированного сигнала со скачкообразно изменяющейся от импульса к импульсу по случайному закону несущей частотой измеряют их длительность, период следования и несущие частоты, в случае соответствия результатов измерения каталожным значениям параметров зондирующего информационного сигнала подавляемой системы формируют помеховые сигналы, представляющие собой радиоимпульсы с теми же длительностью, периодом следования и несущей частотой, что и принятые зондирующие информационные импульсы, но задержанные относительно принятых на время порядка 0, 2 микросекунды и без фазовой манипуляции, при этом каждый из помеховых импульсов формируют в виде немодулированного радиоимпульса той же длительности, что и принятые зондирующие информационные радиоимпульсы. 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 117.  ПЬЕЗОЭЛЕКТРИЧЕСКИЙ КЕРАМИЧЕСКИЙ МАТЕРИАЛ
Изобретение относится к пьезоэлектрическим керамическим материалам. Технический результат изобретения заключается в снижении относительной диэлектрической проницаемости и температуры спекания материала. Пьезоэлектрический керамический материал содержит следующие компоненты, мас. %: PbO 64, 36-64, 43; Nb2 O5 22, 72-23, 04; TiO2 3, 43-3, 80; BaO 2, 32-2, 33; MgO 0, 19-0, 22; NiO 0, 35-0, 40; ZnO 6, 17-6, 18. 2 пр. , 3 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 118.  ПЬЕЗОЭЛЕКТРИЧЕСКИЙ КЕРАМИЧЕСКИЙ МАТЕРИАЛ
Изобретение относится к пьезоэлектрическим керамическим материалам. Технический результат изобретения заключается в снижении механической добротности, относительной диэлектрической проницаемости поляризованных образцов, в повышении пьезомодуля, пьезочувствительности, удельной чувствительности, коэффициента электромеханической связи планарной моды колебаний. Пьезоэлектрический керамический материал содержит следующие элементы, мас. %: Na2O 8, 77-8, 84; K2O 11, 36-11, 44; Li2O 0, 32-0, 33; Ta 2O5 11, 58-11, 67; Sb2O5 3, 53-3, 56; Nb2O5 62, 71-63, 17; NiO 0, 99-1, 73. 3 табл. , 3 пр.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 119.  ПЬЕЗОЭЛЕКТРИЧЕСКИЙ КЕРАМИЧЕСКИЙ МАТЕРИАЛ
Изобретение относится к пьезоэлектрическим керамическим материалам. Технический результат изобретения заключается в повышении коэффициента электромеханической связи планарной моды колебаний, снижении относительной диэлектрической проницаемости. Пьезоэлектрический керамический материал содержит следующие компоненты, мас. %: Na 2O 8, 61-8, 70; К2O 11, 15-11, 26; Li2 O 0, 49-0, 50; Та2O5 11, 37-11, 49; Nb 2O3 61, 59-62, 19; Bi2O3 0, 37-1, 10; Fe2O3 0, 13-0, 38; Sb2 O5 5, 31-5, 37. 3 пр. , 3 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 120.  ПЬЕЗОЭЛЕКТРИЧЕСКИЙ КЕРАМИЧЕСКИЙ МАТЕРИАЛ
Изобретение относится к пьезоэлектрическим керамическим материалам. Технический результат изобретения заключается в снижении относительной диэлектрической проницаемости и механической добротности, в повышении пьезочувствительности, коэффициента электромеханической связи планарной моды колебаний, скорости звука. Пьезоэлектрический керамический материал содержит следующие компоненты, мас. %: Na2O 9, 41-9, 51; K2O 12, 25-12, 42; CdO 0, 75-1, 12; Nb2O5 77, 22-77, 32. 3 пр. , 3 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 121.  СПОСОБ ИЗВЛЕЧЕНИЯ ЭЛЕМЕНТОВ-ПРИМЕСЕЙ ИЗ МИНЕРАЛЬНОГО СЫРЬЯ
Изобретение относится к извлечению цветных, редких и благородных металлов из минерального сырья, например, из углей, отходов их обогащения и сжигания. Исходное минеральное сырье измельчают до фракции 0, 25-0, 5 мм, смешивают с водой в равном соотношении, загружают в рабочий объем автоклавной установки на 2/ 3 его объема, герметизируют запирающей мембраной и нагревают до температуры, значение которой соответствует максимуму давления на термобарограмме, полученной для данного сырья методом вакуумной декриптометрии. После окончания процесса выщелачивания вскрывают запирающую мембрану, при этом твердо-газово-жидкостный поток из замкнутого объема высокого давления со сверхзвуковой скоростью выбрасывается в вакуум реакционной камеры, отражается от ее цилиндрической стенки, создавая обратную взрывную волну, что приводит к интенсивному флюидно-термическому растворению данного вида сырья. Техническим результатом является повышение выхода ценных элементов-примесей из минерального сырья за счет повышения интенсивности процесса деструкции металлоорганических соединений при обработке сырья с разной степенью метаморфизм. 3 з. п. ф-лы, 7 ил. , 4 табл.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 122.  СПОСОБ ЗАЖИГАНИЯ ДВИГАТЕЛЯ АВТОМОБИЛЯ
Изобретение относится к автомобильной промышленности, а именно к электрооборудованию для обеспечения работы двигателей внутреннего сгорания, и может быть использовано в производстве и эксплуатации автомобилей. Технический результат - повышение полноты сгорания рабочей смеси. Способ заключается в том, что с каждым оборотом двигателя фиксируют момент прохождения поршнем цилиндра двигателя характерной (реперной) точки, измеряют период оборота коленвала и нагрузку на двигатель, по результатам этих измерений определяют оптимальный угол опережения зажигания и в момент прохождения поршнем цилиндра двигателя точки, опережающей верхнюю мертвую точку на угол, равный рассчитанному оптимальному углу опережения зажигания, формируют импульс зажигания в цепи управления катушкой зажигания и на свечах зажигания, дополнительно измеряют температуру двигателя, температуру рабочей смеси и длительность открытия топливной форсунки, а при определении оптимального угла опережения зажигания для каждого из его возможных значений рассчитывают зависимость давления в цилиндре двигателя от угла поворота коленвала с учетом результатов этих измерений, по рассчитанной зависимости определяют тот угол поворота коленвала, для которого это давление максимально, при этом в качестве грубого значения оптимального угла опережения зажигания принимают то из них, при котором угол поворота коленвала, соответствующий максимальному давлению в цилиндре, наиболее близок к заданному, выбираемому в пределах от 185° до 195° , измеряют фактический угол поворота коленвала, при котором давление в цилиндре максимально, а в качестве уточненного значения оптимального угла опережения зажигания принимают его грубое значение, уменьшенное на разность между заданным и измеренным в предыдущем обороте коленвала фактическим значением угла поворота коленвала, соответствующего максимуму давления в цилиндре. 2 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 123.  Способ определения жизнеспособности некультивируемых форм vibrio cholerae о1/ о139 по экспрессии рибулозо-дифосфат-карбоксилазы
Изобретение относится к медицинской микробиологии и может быть использовано для определения жизнеспособности некультивируемых форм (НФ) Vibrio cholerae O1/ O139 в водных объектах при мониторинговых исследованиях, в научно-исследовательской работе с НФ в экспериментах по индукции НС, при изучении устойчивости НФ к физическим и химическим воздействиям, в других исследованиях, в которых необходимо подтвердить жизнеспособность культуры, нивелировав отсутствие роста НФ на плотных питательных средах. Способ заключается в том, что проводят предварительную подготовку контрольных вегетативных культур V. cholerae O1 и V. cholerae O139 и исследуемых образцов, определяют во всех образцах концентрацию белка по Лоури, параллельно из всех образцов готовят препараты раздавленная капля с акридиновым оранжевым, фиксируя в люминесцентном микроскопе характер флуоресценции (зеленая - жизнеспособные, красная/ оранжевая - мертвые), с последующим определением активности рибулозо-дифосфат-карбоксилазы (РДФК) радиоизотопным методом с меченым бикарбонатом. Результаты учитывают в сцинтилляционном счетчике, выражают в имп. мин/ мкг белка. Наличие в исследуемой пробе активности РДФК указывает на жизнеспособность НФ V. cholerae O1/ O139. Использование способа позволяет определить жизнеспособность НФ V. cholerae O1/ O139 разного возраста в водной среде различного состава.
email: inno@sfedu.ru, тел. : (863) 218-40-90
 124.  ПЬЕЗОЭЛЕКТРИЧЕСКИЙ КЕРАМИЧЕСКИЙ МАТЕРИАЛ
Изобретение относится к пьезоэлектрическим керамическим материалам на основе соединений свинца, титана, ниобия, магния, германия, циркония и может быть использовано в электромеханических преобразователях, стабильно работающих в диапазоне температур от 25° C до 240° C, одним из основных критериев работы которых является низкий предел допускаемой дополнительной погрешности измерения, вызванной изменением температуры окружающей среды в указанном диапазоне. Пьезоэлектрический керамический материал на основе титаната свинца содержит оксиды свинца, титана, ниобия, магния, германия, циркония при следующем соотношении компонентов в мас. %: РbО 69, 13-69, 27; Nb2O5 7, 82-8, 07; TiO2 9, 71-10, 21; GеO2 0, 65; MgO 1, 18-1, 22; ZrO2 10, 87-11, 22. Технический результат изобретения: введение в материал оксида германия приводит к формированию более совершенной кристаллической структуры, минимизирует флуктуации состава, плотности и пр. и, как следствие, стабилизирует пьезо- и диэлектрические свойства материала. 2 табл. , 1 ил.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 125.  База данных геоботанических описаний Ростовской области
База данных представляет собой реестр данных геоботанической съемки Ростовской области и включает в себя 235 описаний. База данных предназначена для анализа и оценки количественных критериев фитобиоразнообразия степей бассейна Дона и ресурсной базы природных кормовых угодий.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 126.  Растительный покров бассейна Дона
База данных представляет собой реестр фотографий растительного покрова Ростовской области в количестве 848 шт. База данных может быть использована при создании экологической сети бассейна Дона.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 127.  База данных сосудистых растений (аннотированный список) территории Островного участка Государственного природного биосферного заповедника Ростовский
База данных высших сосудистых растений Островного участка заповедника Ростовский включает в себя 273 вида, относящихся к 44 семействам. 13 видов относятся к редким и находящимся под угрозой исчезновения. База данных предназначена для оценки природоохранной значимости степных растительных сообществ и может быть использована для создания многоуровневой модели биомониторинга.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 128.  Биомаркеры состояния мужской репродуктивной системы в околопубертатный период
База данных содержит информацию о биохимических маркерах, в том числе об уровне гормонов щитовидной железы, половых гормонов, гормонов надпочечников и т. д. у мальчиков околопубертатного возраста, проживающих в Ростове-на-Дону. База данных содержит информацию о генетических маркерах, в том числе о частоте полиморфных вариантов генов, ассоциированных с риском нарушений формирования половой функции. База данных позволяет анализировать данные в зависимости от возраста, массы тела, степени развития половой системы; позволяет проводить поиск и анализ данных по функциональным, возрастным и нозологическим группам. База данных может применяться в биомедицинских исследованиях.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 129.  База данных геоботанических описаний растительности террасных степей долины Западного Маныча (охранная зона заповедника Ростовский, 2013)
База данных представляет собой реестр данных геоботанических описаний степной растительности Западного Маныча и включает в себя 23 описания. База данныз предназначена для выполнения эколого-флористической классификации, анализа и оценки количественных критериев фитобиоразнообразия степной растительности Ростовской области.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 130.  База данных потоков парниковых газов и нефтяных компонентов в ландшафтах Ростовской области
База данных (БД) предназначена для геоинформационного анализа баз фактических данных, сопряженных с векторной картой ландшафтов Ростовской области. Используемая для работы с базой данных СУБД позволяет получить интегральные количественные характеристики потоков метана с поверхности различных наземных и аквальных ландшафтов в атмосферу, потоков углеводородов и смолистых нефтяных компонентов с водосборной территории в донные отложения р. Дон и Азовского моря. БД составлена по материалам собственных исследований. Имеется возможность интеграции предлагаемой БД с геоинформационной системой ArcGIS с последующим использованием в учебном процессе. БД позволяет формировать выборки по различным критериям и фильтрам, благодаря которым возможно отслеживать экологическое состояние исследуемого региона. Полученные результаты могут быть использованы при нормировании антропогенных нагрузок, разработке экологических проектов и планов по ликвидации последствий чрезвычайных ситуаций техногенного характера, в системе мониторинга наземных ландшафтов, поверхностных вод суши и прибрежных морских акваторий.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 131.  База данных геоботанических описаний растительности разнотравно-дерновиннозлаковых степей бассейна Среднего Дона, выделенных в ассоциацию Trifolio alpesris-Stipetum tirsae Demina 2012 (в пределах Ростовской области, 2013)
База данных представляет собой реестр данных геоботанических описаний степной растительности в истоках рек Калитва и Тихая и включает в себя 66 описаний. Предназначена для выполнения эколого-флористической классификации, анализа и оценки количественных критериев фитобиоразнообразия степной растительности Ростовской области.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 132.  Коллекция тропических растений Ботанического сада Южного федерального университета
База данных представляет собой перечень образцов тропических растений, их текущее состояние и место расположения. Содержит 905 образцов, включая 721 вид, 298 родов, 87 семейств. Предназначена для учёта коллекционных фондов Ботанического сада Южного федерального университета, будет использоваться в ходе учебного процесса.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 133.  Коллекция редких плодовых и орехоплодных растений Ботанического сада Южного федерального университета
База данных представляет собой перечень образцов плодовых растений, их текущее состояние и место расположения. Содержит 92 образца, включая 29 видов, 16 родов, 13 семейств. Предназначена для учёта коллекционных фондов Ботанического сада Южного федерального университета, будет использоваться в ходе учебного процесса.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 134.  Коллекция растений природной флоры и травянистых растений Ботанического сада Южного федерального университета
База данных представляет собой перечень образцов травянистых растений, их текущее состояние и место расположения. Содержит 1324 образца, включая 874 вида, 410 родов, 89 семейств. Предназначена для учета коллекционных фондов Ботанического сада.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 135.  Дендрологическая коллекция Ботанического сада Южного федерального университета
База данных представляет собой перечень образцов древесных растений, их текущее состояние и место расположения. Содержит 1465 образцов, включая 1020 видов, 201 род, 73 семейства. Предназначена для уч та коллекционных фондов Ботанического сада Южного федерального университета, будет использоваться в ходе учебного процесса.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 136.  Количественные учёты на светоловушки огнёвкообразных чешуекрылых (Lepidoptera: Pyraloidea) Ростовской области в 1980-2013 гг.
База данных включает 230 видов огнёвок, относящихся к 4-м семействам: Pyralidae, Pyraustidae, Crambidae, Phycitidae. Основная таблица данных включает 5844 строк записей о пунктах, датах и числе экземпляров огнёвок каждого вида. В период 1980-2013 гг. за 624 даты ночных учётов собрано 107475 экз. огнёвок. База данных является единственным научным источником объективной информации об относительной численности и видовом составе фаунистических комплексов огнёвок в указанный период времени. Может использоваться в аналитических исследованиях по биологическому разнообразию и по динамике видового состава огнёвок, включая сельскохозяйственных вредителей.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 137.  База данных параметров многокритериальной модели социально-экологического риска территории крупных городов
База данных предназначена для обобщения и структуризации материалов (исходных данных) анализа социально-экологической безопасности крупных городов. База данных организована по реляционному типу и включает информацию о видах заболеваний, динамике общего уровня заболеваемости населения, а также характеристику величины социально-экологического рисков городских территории, обусловленных экологическими нарушениями территориальной среды в результате реализации различных градостроительных проектов. База данных может применяться в оценке текущего уровня и при планировании программы социально-экономического развития города, в качестве основы ранжирования урбанизированных территорий по уровню заболеваемости населения и степени социально-экономического ущерба от снижения качества окружающей среды крупных городов.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 138.  База данных по индукции экспрессии оперонов SOS-репарации и окислительного стресса у бактерий под действием лекарств-мутагенов (диоксидина, нитрофуранов и цисплатины)
База данных представляет собой реестр данных по количественным параметрам индукции экспрессии оперонов SOS-репарации и окислительного стресса у прокариотических микроорганизмов под действием диоксидина, нитрофуранов и цисплатины. Предназначена для подбора максимально эффективных доз при планировании экспериментов по установлению уровня индуцированного мутагенеза под действием данных препаратов, а также оценки риска возникновения и накопления мутаций устойчивости к антимикробным агентам при применении терапевтических доз диоксидина, нитрофуранов и цисплатины в клинической практике. Для каждого препарата даны: краткая характеристика, описание метода регистрации индукции экспрессии оперонов SOS-репарации и окислительного стресса, диапазон действующих концентраций, максимально эффективная концентрация, максимальные коэффициенты индукции, кривые доза-эффект.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 139.  Урожайность пшеницы на госсортоучастках Ростовской области
База данных содержит информацию об урожайности сортов пшеницы отечественной и зарубежной селекции на госсортоучастках Ростовской области с их отклонениями от стандартов, осуществления удобного доступа к ним и поиска объектов селекционной базы по заданным параметрам. Интерфейс базы данных позволяет: задать значения некоторых параметров записей; получить список данных по результатам поиска; получить описания искомых данных, вывести полученные результаты запроса на печатающее устройство.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 140.  Урожайность кукурузы на госсортоучастках Ростовской области
База данных содержит информацию об урожайности сортов и гибридов кукурузы отечественной и зарубежной селекции на госсортоучастках Ростовской области с их отклонениями от стандартов, осуществления удобного доступа к ним и поиска объектов селекционной базы по заданным параметрам. Интерфейс базы данных позволяет: задать значения некоторых параметров записей; получить список данных по результатам поиска; получить описания искомых данных, вывести полученные результаты запроса на печатающее устройство.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 141.  Урожайность гороха на госсортоучастках Ростовской области
База данных содержит информацию об урожайности сортов и гибридов гороха отечественной и зарубежной селекции на госсортоучастках Ростовской области с их отклонениями от стандартов, осуществления удобного доступа к ним и поиска объектов селекционной базы по заданным параметрам. Интерфейс базы данных позволяет: задать значения некоторых параметров записей; получить список данных по результатам поиска; получить описания искомых данных; вывести полученные результаты запроса на печатающее устройство.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 142.  Мощность эквивалентной дозы гамма-излучения природных и урбанизированных территорий Краснодарского края
В базе данных представлены данные по радиоактивности городских, степных и лесных территорий Краснодарского края. База данных предназначена для оценки влияния гамма-фона на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 143.  Удельная активность 226Ra, 232Th, 40К в почвах зоны наблюдения Ростовской АЭС за период с 2010 по 2014 годы
В базе данных представлены данные по содержанию и распределению естественных радионуклидов 226Ra, 232Th, 40К в почвах степной зоны расположения Ростовской АЭС. База данных предназначена для оценки влияния искусственных радионуклидов на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 144.  Удельная активность 137Cs в почвах зоны наблюдения Ростовской АЭС за период с 2000 по 2008 годы
В базе данных представлены данные по содержанию и распределению искусственного радионуклида b7Cs в почвах степной зоны расположения Ростовской АЭС. База данных предназначена для оценки влияния искусственных радионуклидов на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 145.  Удельная активность радионуклидов в приземном слое воздуха города Ростова-на-Дону
В базе данных представлены данные по содержанию естественных и искусственных радионуклидов в атмосферных аэрозолях, отобранных в приземном слое воздуха г. Ростова-на-Дону. База данных предназначена для оценки влияния радионуклидов на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 146.  Мощность эквивалентной дозы гамма-излучения природных и урбанизированных территорий Ростовской области
В базе данных представлены данные по радиоактивности городских, степных и лесных территорий Ростовской области. База данных предназначена для оценки влияния гамма-фона на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 147.  Удельная активность радионуклидов в почвах природно-техногенной зоны Новочеркасской ГРЭС
В базе данных представлены данные по содержанию и распределению искусственного радионуклида 137Cs и естественных радионуклидов в почвах степной зоны на территории природно-техногенной зоны расположения Новочеркасской ГРЭС. База данных предназначена для оценки влияния искусственных радионуклидов на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 148.  Мощность эквивалентной дозы гамма-излучения природных и урбанизированных территорий республики Адыгея
В базе данных представлены данные по радиоактивности городских, степных и лесных территорий республики Адыгея. База данных предназначена для оценки влияния гамма-фона на население и окружающую среду с учетом фоновых и повышенных значений мощности эквивалентной дозы.
344006, г. Ростов-на-Дону, ул. Б. Садовая, 105/ 42 email: inno@sfedu.ru тел. : (863) 218-40-90 fax: (863) 218-40-90 web: www. sfedu.ru
 149.  Патент на изобретение Способ получения гидролизата из плодов и кожуры бананов в качестве стимулятора роста для культивирования лептоспир
Лисицын Сергей Викторович, тел. раб. : 7 (8652) 33-06-84, сот. : 7 (962)-449-50-38 Email: slisitcyn@ncfu.ru, ckp@ncfu.ru
 150.  Патент на изобретение Питательная среда плотная для культивирования возбудителя листериоза
Лисицын Сергей Викторович, тел. раб. : 7 (8652) 33-06-84, сот. : 7 (962)-449-50-38 Email: slisitcyn@ncfu.ru, ckp@ncfu.ru
 151.  Патент на изобретение Регенерирующая композиция для ухода за кожей
Лисицын Сергей Викторович, тел. раб. : 7 (8652) 33-06-84, сот. : 7 (962)-449-50-38 Email: slisitcyn@ncfu.ru, ckp@ncfu.ru
 152.  Передвижной фрезерный модуль для обработки крупногабаритных деталей кольцевого типа
(4722)55-41-61
 153.  Классифицирующая футеровка цементной мельницы
(4722)55-41-61
 154.  Пневмокамерный насос для транспортировки сыпучих материалов
(4722)55-41-61
 155.  Виброизолятор
(4722)55-41-61
 156.  Устройство бесконтактного измерения шероховатости
(4722)55-41-61
 157.  Цементная вращающаяся печь с высокотем-пературным теплообменником для зоны декарбонизации
(4722)55-41-61
 158.  Адаптивная приставка к двухпозиционному регулятору
(4722)55-41-61
 159.  Манипулятор-трипод с шестью степенями подвижности
(4722)55-41-61
 160.  Трубная мельница
(4722)55-41-61
 161.  Способ изготовления стеновых керамических изделий с использованием измельченных кристаллизованных стекол, шихта для стеновых керамических изделий и заполнитель для стеновых керамических изделий
(4722)55-41-61
 162.  Способ изготовления стеновых керамических изделий с использованием осадочных высококремнеземистых пород, шихта для стеновых керамических изделий и заполнитель для стеновых керамических изделий
(4722)55-41-61
 163.  Станок для обработки вкладышей крупногабаритных подшипников скольжения
(4722)55-41-61
 164.  Устройство для мониторинга параметров свинцового аккумулятора в реальном времени
(4722, )55-41-61
 165.  Роторно-пульсационная установка для производства пенобетона
(4722)55-41-61
 166.  Комплексная органическая добавка для ингибирования щелочной коррозии
(4722)55-41-61
 167.  Муфта
(4722)55-41-61
 168.  Буровое шарошечное долото
(4722)55-41-61
 169.  Эпоксидное связующее для стеклопластиков
(4722)55-41-61
 170.  Адаптивный электромеханический регулятор подачи электрода-инструмента электроэрозион-ного станка
(4722)55-41-61
 171.  Способ получения направленных механических колебаний и устройство для его осуществления.
(4722)55-41-61
 172.  Суспензия для получения токопроводящего покрытия
(4722)55-41-61
 173.  Сепаратор
(4722)55-41-61
 174.  Печь моллирования с нижним разогревом и интенсификационным верхним нагревателем
(4722)55-41-61
 175.  Зернистый фильтр
(4722)55-41-61
 176.  Вибровращательная мельница
(4722)55-41-61
 177.  Композиционный материал для радиационной защиты
(4722)55-41-61
 178.  Способ изготовления декоративных бетонных изделий
(4722)55-41-61
 179.  Пневмосмеситель многокомпонентных сухих строительных смесей
(4722)55-41-61
 180.  Маслообразователь непрерывного действия
(4722)55-41-61
 181.  Центробежный гомогенизатор
(4722)55-41-61
 182.  Способ реализации двухпозиционного регулятора
(4722)55-41-61
 183.  Быстросоединительное устройство
(4722)55-41-61
 184.  Способ изготовления стеновых керамических изделий
(4722)55-41-61
 185.  Циклон
(4722)55-41-61
 186.  Водогрейный котел
(4722)55-41-61
 187.  Конденсационный водогрейный котел
(4722)55-41-61
 188.  Способ очистки сточных вод
(4722)55-41-61
 189.  Сырьевая смесь для получения силикатных изделий с использованием отходов алмазодобывающей промышленности
(4722)55-41-61
 190.  Приставной зубофрезерный станок
(4722)55-41-61
 191.  Устройство бесконтактного измерения шероховатости поверхностей деталей сложной формы
(4722)55-41-61
 192.  Узловое бесфасоночное соединение трубчатых элементов фермы (варианты)
(4722)55-41-61
 193.  Гранулированный заполнитель на основе стеклобоя для бетонной смеси, состав бетонной смеси для получения бетонных строительных изделий, способ получения бетонных строительных изделий и бетонное строительное изделие.
(4722)55-41-61
 194.  Гранулированный заполнитель на основе природных осадочных высококремнеземистых пород для бетонной смеси, состав бетонной смеси для получения бетонных строительных изделий, способ получения бетонных строительных изделий и бетонное строительное изделие
(4722)55-41-61
 195.  Гранулированный композиционный заполнитель для силикатных стеновых изделий на основе кварцевого песка, состав сырьевой смеси для изготовления силикатных стеновых изделий, способ получения силикатных стеновых изделий и силикатное стеновое изделие
(4722)55-41-61
 196.  Гранулированный композиционный заполнитель для силикатных стеновых изделий на основе трепела, диатомита и опоки, состав сырьевой смеси для изготовления силикатных стеновых изделий, способ получения силикатных стеновых изделий и силикатное стеновое изделие
(4722)55-41-61
 197.  Гранулированный заполнитель для силикатных стеновых изделий на основе кремнистых цеолитовых пород, состав сырьевой смеси для изготовления силикатных стеновых изделий, способ получения силикатных стеновых изделий и силикатное стеновое изделие.
(4722)55-41-61
 198.  Гранулированный заполнитель на основе перлита для бетонной смеси, состав бетонной смеси для получения строительных изделий, способ получения бетонных строительных изделий и бетонное строительное изделие
(4722)55-41-61
 199.  Гранулированный заполнитель на основе кремнистых цеолитовых пород для бетонной смеси, состав бетонной смеси для получения строительных изделий, способ получения бетонных строительных изделий и бетонное строительное изделие
(4722)55-41-61
 200.  Гранулированный заполнитель для силикатных стеновых изделий на основе стеклобоя, состав сырьевой смеси для изготовления силикатных стеновых изделий, способ получения силикатных стеновых изделий и силикатное стеновое изделие.
(4722)55-41-61
 201.  Тестоделитель
(4722)55-41-61
 202.  Барабанно-винтовой сушильный агрегат
(4722)55-41-61
 203.  Способ получения теплоизоляционного облицовочного материала на основе пеностекла
(4722)55-41-61
 204.  Способ активации шихты для производства пеностекла
(4722)55-41-61
 205.  Трубная мельница с внутримельничным классифицирующим устройством
(4722)55-41-61
 206.  Водогрейный котел
(4722)55-41-61
 207.  Двухвальный смеситель периодического действия
(4722)55-41-61
 208.  Сухая смесь для теплоизоляционного неавтоклав-ного пеногазобетона
(4722)55-41-61
 209.  Формовочная смесь для пенобетона
(4722)55-41-61
 210.  Растворная смесь
(4722)55-41-61
 211.  Фильтрующий материал для очистки сточных вод
(4722)55-41-61
 212.  Биореактор
(4722)55-41-61
 213.  Автоматический шаговый линейный электрогид-равлический привод
(4722)55-41-61
 214.  Свая повышенной несущей способности
(4722)55-41-61
 215.  Способ усиления рыхлых оснований фундаментов направленным горизонтальным площадным гидроразрывом и устройство для горизонтального гидроразрыва
(4722)55-41-61
 216.  Способ рекультивации карьеров с использованием промышленных отходов
(4722)55-41-61
 217.  Винтовая свая для рыхлых грунтов
(4722)55-41-61
 218.  Рабочее оборудование одноковшового гидравлического экскаватора
(4722)55-41-61
 219.  Композиционный материал на основе глинистых масс и металлического наполнителя
(4722)55-41-61
 220.  Цепь для цепной завесы вращающейся печи (варианты)
(4722)55-41-61
 221.  Свая забивная железобетонная для химического закрепления рыхлых песков и способ закрепления грунта, окружающего тело сваи
(4722)55-41-61
 222.  Способ получения композиционного вяжущего, композиционное вяжущее для производства прессованных изделий автоклавного твердения, прессованное изделие
(4722)55-41-61
 223.  Теплоизоляционный фундамент
(4722)55-41-61
 224.  Устройство для определения отклонения оси крупногабаритного вращающегося объекта
(4722)55-41-61
 225.  Фунгицидный модификатор минеральных строительных композиций
(4722)55-41-61
 226.  Бандаж вращающейся печи
(4722)55-41-61
 227.  Шестиосевая координатно-измерительная машина
(4722)55-41-61
 228.  Пневмосмеситель непрерывного действия для производства сухих строительных смесей
(4722055-41-61
 229.  Сырьевая смесь для изготовления пенобетона на наноструктурированном перлитовом вяжу-щем (варианты)
(4722)55-41-61
 230.  Молотковая дробилка с переменным радиальным зазором между молотком и внутренней рабочей поверхностью
(4722)55-41-61
 231.  Смесительно-помольное устройство с изменя-емой рабочей камерой периодического действия
(4722)55-41-61
 232.  Вибрационно-ценробежный гранулятор
(4722)55-41-61
 233.  Смесь для изготовления керамзитобетона
(4722)55-41-61
 234.  Способ получения вяжущих для бетонов
(4722)55-41-61
 235.  Роторная мельница
(4722)55-41-61
 236.  Вертикальная молотковая мельница
(4722)55-41-61
 237.  Смесь для пенобетона на основе наноструктури-рованного вяжущего (варианты), способ изготов-ления изделий из пенобетона (варианты)
(4722)55-41-61
 238.  Датчик положения рабочих органов
(4722)55-41-61
 239.  Устройство разогрева органических и синтети-ческих продуктов в емкостях
(4722)55-41-61
 240.  Способ формования техногенных материалов и пресс-валковый агрегат для его осуществления
(4722)55-41-61
 241.  Сырьевая смесь и способ ее получения для нано-структурированного автоклавного газобетона
(4722)55-41-61
 242.  Станок для обработки внутренних поверхностей цапф помольных мельниц
(4722)55-41-61
 243.  Гранулированный наноструктурирующий заполнитель на основе высококремнеземистых компонентов для бетонной смеси, состав бетонной смеси для получения бетонных строительных изделий и бетонное строительное изделие
(4722)55-41-61
 244.  Устройство для электроэрозионной обработки
(4722)55-41-61
 245.  Шаровая мельница замкнутого цикла
(4722)55-41-61
 246.  Захватное устройство для кабин грузовых автомобилей
(4722)55-41-61
 247.  Диффузионная газовая горелка
(4722)55-41-61
 248.  Пресс-валковый экструдер
(4722)55-41-61
 249.  Вальцовый пресс для брикетирования порош-кообразных материалов
(4722)55-41-61
 250.  Статический смеситель
(4722)55-41-61
 251.  Известково-кремнеземистое вяжущее, способ приготовления известково-кремнеземистого вяжущего и способ приготовления силикатной смеси на основе известково-кремнеземистого вяжущего для прессования изделий автоклавного твердения
(4722)55-41-61
 252.  Известковое вяжущее, способ приготовления известкового вяжущего и способ приготовления силикатной смеси на основе известкового вяжущего для прессованных изделий автоклавного твердения
(4722)55-41-61
 253.  Способ приготовления смеси для ячеистых силикатных строительных изделий и строительное изделие
(4722)55-41-61
 254.  Способ приготовления смеси для изготовления легких силикатных строительных изделий и строительное изделие
(4722)55-41-61
 255.  Способ приготовления смеси для силикатного кирпича и силикатный кирпич
(4722)55-41-61
 256.  Способ получения минерального порошка для асфальтобетонной смеси
(4722)55-41-61
 257.  Полимерно-битумное вяжущее и способ его получения
(4722)55-41-61
 258.  Приставной станок для обработки внутренних поверхностей цилиндрического типа
(4722)55-41-61
 259.  Опора вращающейся обжиговой цементной печи
(4722)55-41-61
 260.  Барабанный магнитный сепаратор
(4722)55-41-61
 261.  Устройство для измерения шероховатости отверстий
(4722)55-41-61
 262.  Шаровая барабанная мельница с классифи-цирующим разгрузочным устройством
(4722)55-41-61
 263.  Шаровая барабанная мельница с внутренним рециклом
(4722)55-41-61
 264.  Установка для механоактивации суспензий, содержащих волокнистые материалы
(4722)55-41-61
 265.  Водогрейный котел М. И. Кулешова
(4722)55-41-61
 266.  Устройство для помола материалов с одновременной сепарацией
(4722)55-41-61
 267.  Чистящая головка
(4722)55-41-61
 268.  Маневренная газотурбинная теплоэлектро-централь
(4722)55-41-61
 269.  Роторная дробилка
(4722)55-41-61
 270.  Гранулятор волокнистых материалов
(4722)55-41-61
 271.  Способ получения железоокисных пигментов
(4722)55-41-61
 272.  Сырьевая смесь для получения силикатных изделий с использованием вскрышных пород горнодобывающей промышленности
(4722)55-41-61
 273.  Способ получения многослойного строительного изделия на основе высококонцентрированной суспензии кремнеземсодержащего сырья (варианты), способ получения формовочной смеси для несущих функциональных слоев (варианты), способ получения теплоизоляционного материала для многослойного строительного изделия, многослойное строительное изделие (варианты)
(4722)55-41-61
 274.  Горелка инжекционная диффузионная (варианты) и дроссельный механизм
(4722)55-41-61
 275.  Лазерное устройство для определения погрешности формы крупногабаритных объектов
(4722)55-41-61
 276.  Способ адаптивного двухпозиционного регулирования
(4722)55-41-61
 277.  Установка для пневматической механоактивации цемента
(4722)55-41-61
 278.  Шестиосевая координатно-измерительная машина с пассивной упруго-деформирующей системой
(4722)55-41-61
 279.  Приставной вертикальный зубофрезерный станок
(4722)55-41-61
 280.  Приставной вертикальный зубофрезерный станок для ремонтной обработки прямозубых зубчатых колес
(4722)55-41-61
 281.  Устройство автоматического натяжения ремня
(4722)55-41-61
 282.  Способ получения защитно-декоративных покрытий на изделиях из стеновой керамики
(4722)55-41-61
 283.  Следящий суппорт
(4722)55-41-61
 284.  Смеситель для перемешивания сыпучих материалов
(4722)55-41-61
 285.  Горизонтальная валковая мельница
(4722)55-41-61
 286.  Винтовой классификатор
(4722)55-41-61
 287.  Трубная мельница с классифицирующей перегородкой
(4722)55-41-61
 288.  Система адаптивного двухпозиционного управления
(4722)55-41-61
 289.  Ремонтно-строительный пылесос-комбайн
(4722)55-41-61
 290.  Устройство для электроэрозионной обработки
(4722)55-41-61
 291.  Шаровая загрузка барабанной мельницы
(4722)55-41-61
 292.  Устройство для определения погрешности формы крупногабаритных объектов
(4722)55-41-61
 293.  Устройство бесконтактного определения шероховатости отверстий малого диаметра
(4722)55-41-61
 294.  Эжекционная машина для смешения и микрогранулирования техногенных материалов
(4722)55-41-61
 295.  Способ изготовления гранулированного заполнителя для бетона
(4722)55-41-61
 296.  Способ изготовления гранулированного заполнителя для силикатных изделий автоклавного твердения
(4722)55-41-61
 297.  Приставной сверлильный станок для сверления и растачивания отверстий в крупногабаритных фланцевых соединениях
(4722)55-41-61
 298.  Способ изготовления стеновых керамических изделий
(4722)55-41-61
 299.  Прибор с зарядовой связью для контроля динамики трещин в строительных конструкциях
(4722)55-41-61
 300.  Способ изготовления керамических изделий
(4722)55-41-61
 301.  Система автоматического регулирования отопления здания с учетом климатических факторов
(4722)55-41-61
 302.  Система автоматического регулирования отопления по двум фасадам здания с теплообменником
(4722)55-41-61
 303.  Устройство для утилизации тепла дымовых газов
(4722)55-41-61
 304.  Устройство вращения крупногабаритных вращающихся агрегатов
(4722)55-41-61
 305.  Станок для обработки бандажей
Станок для обработки бандажей, имеющий опорные стойки, в которых установлена направляющая, несущая суппорт с резцедержателем, отличающийся тем, что суппорт снабжен подпружиненной пинолью, на конце которой шарнирно закреплена роликовая тележка, несущая резцедержатель с резцом, установленный между двумя роликами с возможностью осевого выдвижения.
(4722)55-41-61
 306.  Станок для обработки бандажей и опорных роликов
Станок для обработки бандажей и опорных роликов, содержащий опорные стойки с разрезными головками, в которых установлена направляющая со шпонкой, несущая продольный подвижный суппорт с резцедержателем, отличающийся тем, что левая опорная стойка снабжена переходником, несущим сменный привод продольных подач, состоящий из мотора-редуктора продольных рабочих подач, механизма переключения рабочих подач продольного суппорта и дополнительного переходника для установки привода ускоренных подач.
(4722)55-41-61
 307.  Помольно-смесительное устройство периодичес-кого действия
1. Помольно-смесительное устройство периодического действия, состоящее из корпуса с шаровыми мелющими телами и мешалкой, отличающееся тем, что мешалка выполнена в виде вертикальных стержней разной длины, расположенных на диске, закрепленном на валу, центр расположения стержней смещен относительно центра диска, стержни имеют Г-образную форму. 2. Устройство по п. 1, отличающееся тем, что при отсутствии мелющих тел оно работает как смеситель.
(4722)55-41-61
 308.  Станок для обработки бандажей и роликов
Станок для обработки бандажей и роликов, содержащий опорные стойки, в которых установлена направляющая, несущая суппорт с резцедержателем, и корпуса подшипников роликоопор, отличающийся тем, что он снабжен сменными технологическими наладками для базирования на корпусах подшипников роликоопор, при этом стойки выполнены подвижными с возможностью фиксированного осевого перемещения.
(4722)55-41-61
 309.  Дезинтегратор
Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным патрубками и с размещенными в цилиндрическом корпусе с возможностью встречного вращения верхним и нижним горизонтальными дисками с жестко закрепленными по концентрическим окружностям ударными элементами, каждый из которых расположен между ударными элементами противолежащего диска, разбрасывающие патрубки, установленные под углом на выходе осевого загрузочного патрубка, отличающийся тем, что на оси вращения на выходе загрузочного патрубка жестко закреплен разделительный конус, связанный с боковыми стенками разбрасывающих патрубков посредством разгонных лопаток, на нижней поверхности разбрасывающих патрубков жестко закреплены вентиляционные лопатки, при этом технологический зазор между внешним торцом вентиляционных лопаток и ударными элементами первого внутреннего ряда составляет 0, 1 0, 3d, где d - минимальный размер частиц измельчаемого материала.
(4722)55-41-61
 310.  Вяжущее
Вяжущее, содержащее портландцемент, добавку, содержащую перлит, и суперпластификатор С-3, отличающееся тем, что содержит перлит, механоактивированный с суперпластификатором С-3 путем совместного мокрого помола при соотношении твердого вещества и воды 1: (0, 3-1) до удельной поверхности не менее 20000 см2/ г и высушивания полученной суспензии, при соотношении суперпластификатора С-3 и перлита (0, 01-0, 1): 1.
(4722)55-41-61
 311.  Дезинтегратор
Дезинтегратор для измельчения малоабразивных материалов, внутри которого помещены роторы, разгрузочное устройство и привод, отличающийся тем, что дезинтегратор снабжен двумя дополнительными роторами и приводом, все роторы симметрично расположены в корпусе и выполнены с возможностью вращения внешних рядов ударных элементов в направлении разгрузочного устройства, корпус имеет прямолинейную стенку, а разгрузочное устройство равноудалено от осей вращения роторов и расположено напротив прямолинейной стенки, к корпусу примыкает два загрузочных устройства для подачи измельчаемых материалов в центры вращения роторов, ряды ударных элементов каждой пары роторов расположены по концентрическим окружностям, при этом осевой зазор между внешними рядами ударных элементов двух пар роторов в поперечном сечении камеры помола равнопеременно изменяется и имеет максимальное и минимальное значение через каждые 90° , причем поперечное сечение ударного элемента внешнего ряда пары роторов при минимальном осевом зазоре между внешними рядами ударных элементов двух пар роторов является прямоугольником или близко к прямоугольнику со сторонами b и h, где h=1, 1 1, 2b, а поперечное сечение ударного элемента внешнего ряда пары роторов при максимальном осевом зазоре между внешними рядами ударных элементов двух пар роторов является квадратом или близко к квадрату со стороной b.
(4722)55-41-61
 312.  Вращающаяся цементная печь
Вращающаяся цементная печь содержит уплотнительное устройство лепесткового типа, закрепленное на корпусе холодильной камеры печи, отличающаяся тем, что для удаления пыли из внутреннего пространства, устранения ее выброса в атмосферу и увеличения срока эксплуатации печь снабжена пневмоструйной камерой, содержащей бункер, соединенный трубопроводом со смесительной камерой с конусом, ускоряющим поток воздуха, поступающий из холодильной камеры
(4722)55-41-61
 313.  Аспирационное укрытие мест перегрузки сыпучего материала
Аспирационное укрытие мест перегрузки сыпучего материала, содержащее короб, образованный крышкой, боковыми и торцевыми стенками, эластичные уплотнители, фартуки, закрепленные на торцевых стенках корпуса, аспирационную воронку и загрузочный желоб, отличающееся тем, что боковые стенки расположены под внутренним углом наклона менее 90° к верхней крышке.
(4722)55-41-61
 314.  Дезинтегратор
1. Дезинтегратор для измельчения малоабразивных материалов, включающий цилиндрический корпус, внутри которого размещены роторы с ударными элементами, загрузочное и разгрузочное устройства и каналы для возврата материала в рабочее пространство, отличающийся тем, что камера помола содержит участки дополнительного измельчения материала, а каналы для возврата материала выполнены дугообразными, например в форме параболы, и вынесены за цилиндрический корпус в плоскости камеры помола и имеют высоту, равную высоте цилиндрического корпуса, и ширину, сужающуюся от входа в канал к его выходу в направлении движения измельчаемого материала с наружного ряда ударных элементов, а участки дополнительного измельчения материала, расположенные на внутренней поверхности корпуса между выходной частью канала для возврата материала и разгрузочным патрубком, включают бронеплиты переменного сечения, жестко закрепленные на внутренней поверхности цилиндрического корпуса, при этом зазор между наибольшим диаметром наружного ряда ударных элементов и выступами бронеплит уменьшается от значения а до значения b=1/ 2 1/ 3а в направлении движения материала с наружного ряда ударных элементов, причем ударные элементы наружного ряда имеют радиальную длину в 2 2, 5 раза большую, чем радиальная длина ударных элементов на предыдущих рядах. 2. Дезинтегратор по п. 1, отличающийся тем, что количество дугообразных каналов для возврата материала и участков дополнительного измельчения материала зависит от диаметра цилиндрической части корпуса.
(4722)55-41-61
 315.  Дезинтегратор
Дезинтегратор для измельчения малоабразивных материалов, внутри которого помещены роторы, разгрузочное устройство и привод, отличающийся тем, что дезинтегратор снабжен двумя дополнительными роторами и приводом, все роторы симметрично расположены в корпусе и выполнены с возможностью вращения внешних рядов ударных элементов в направлении разгрузочного устройства, корпус имеет прямолинейную стенку, а разгрузочное устройство равноудалено от осей вращения роторов и расположено напротив прямолинейной стенки, к корпусу примыкают два загрузочных устройства для подачи измельчаемых материалов в центры вращения роторов, разгрузочное устройство снабжено прутковой решеткой, состоящей из двух секторов, сходящихся в точке на оси симметрии дезинтегратора и представляющих дуги окружностей с центрами на осях вращения роторов, при этом зазор между внутренним радиусом секторов решетки и наружным радиусом внешних рядов ударных элементов равен b=(1, 0 2, 0) dисх, где dисх - средневзвешенный размер куска исходного материала, а зазор между смежными прутками решетки не менее 2dгот, где dгот - средневзвешенный размер частицы готового продукта.
(4722)55-41-61
 316.  Дезинтегратор
Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным патрубками и с размещенными в цилиндрическом корпусе с возможностью встречного вращения верхним и нижним горизонтальными дисками с закрепленными по концентрическим окружностям ударными элементами, каждый из которых расположен между ударными элементами противолежащего диска, на выходе осевого загрузочного патрубка под углом к верхнему горизонтальному диску установлены разбрасывающие патрубки, изогнутые в направлении, противоположном направлению вращения верхнего диска, причем на конце каждого из разбрасывающих патрубков закреплен диффузор, больший диаметр D которого равен (0, 6-0, 8)h, где h - высота ударных элементов, м, а угол наклона разбрасывающих патрубков к верхнему горизонтальному диску больше угла естественного откоса измельчаемого материала, при этом расстояние а между торцами диффузоров и ударными элементами превышает максимальный размер измельчаемых частиц, а на нижнем горизонтальном диске под разбрасывающими патрубками установлено устройство для равномерного распределения материала по периметру рабочей камеры, отличающийся тем, что на разбрасывающих патрубках жестко закреплен вертикальный цилиндр с отбойными плитами, при этом расстояние между выступами отбойных плит и ударными элементами первого внутреннего ряда превышает максимальный размер измельчаемых частиц.
(4722)55-41-61
 317.  Дезинтегратор
1. Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным устройствами и с размещенными в корпусе с возможностью встречного вращения верхним и нижним горизонтальными дисками с жестко закрепленными на них рядами ударных элементов, каждый из которых расположен между рядами ударных элементов противолежащего диска, образуя с внутренней поверхностью корпуса камеру помола, отличающийся тем, что ряды ударных элементов расположены по концентрическим окружностям, а осевые зазоры между рядами ударных элементов в поперечном сечении камеры помола равнопеременно изменяются по длине окружности и имеют максимальное и минимальное значение через каждые 180° , причем поперечное сечение ударного элемента при минимальном осевом зазоре между рядами является прямоугольником или близко к прямоугольнику со сторонами b и h, где h=1, 1 1, 2b, а поперечное сечение ударного элемента при максимальном осевом зазоре между рядами является квадратом или близко к квадрату со стороной b, при этом расстояния между ударными элементами в каждом ряду равны между собой, и уменьшаются от центра камеры помола к периферии дисков. 2. Дезинтегратор по п. 1, отличающийся тем, что на верхней поверхности центральной части нижнего диска жестко закреплено устройство для равномерной ускоренной подачи материала на ряды ударных элементов
(4722)55-41-61
 318.  Помольно-смесительный агрегат
Помольно-смесительный агрегат, содержащий станину, загрузочный бункер, вертикальные направляющие, помольные камеры, соединенные между собой патрубками и размещенные на раме, которая связана верхней частью посредством ползунов с направляющими, а нижней - с эксцентриковым валом, имеющим противовесы и размещенным в опорных стойках, закрепленных на станине, отличающийся тем, что эксцентриковый вал содержит два эксцентриковых узла, состоящих из внешнего и внутреннего валов, снабженных сопрягаемыми боковыми параллельными плоскостями и соединенных винтом.
(4722)55-41-61
 319.  Адаптивный инструментальный модуль
Адаптивный инструментальный модуль, содержащий сменный инструментальный блок, выполненный в виде подвижного суппорта, несущего резцедержатель с резцом, и устройство управления, отличающийся тем, что механизмы продольного и поперечного перемещения сменного инструментального блока выполнены в виде прецизионных шариковинтовых передач, каждая из которых связана с соответствующим серводвигателем, резцедержатель соединен с возможностью качания с адаптирующим серводвигателем посредством передаточного механизма, а устройство управления содержит сервоприводы, контроллер и устройство отображения и программирования, при этом все серводвигатели связаны с устройством управления через сервоприводы, управляемые контроллером, имеющим обратную связь с устройством отображения и программирования и датчиком Холла, через усилитель и аналогово-цифровой преобразователь, а блок питания соединен с сервоприводами, контроллером и аналогово-цифровым преобразователем.
(4722)55-41-61
 320.  Сырьевая смесь для изготовления силикатного кирпича
Сырьевая смесь для изготовления силикатного кирпича, содержащая кварцевый песок и известь, отличающаяся тем, что содержит отход, накапливающийся в пылеосадительных системах при сушке гранул керамзита, представляющий собой порошкообразный материал - керамзитовая пыль с удельной поверхностью 670 м2/ кг, при следующем соотношении компонентов, мас. %: известь 8 кварцевый песок 67 керамзитовая пыль 25.
(4722)55-41-61
 321.  Сырьевая смесь для изготовления силикатного кирпича
Сырьевая смесь для изготовления силикатного кирпича, содержащая кварцевый песок и известь, отличающаяся тем, что она дополнительно содержит отход, образующийся при сортировке керамзита и представляющий собой порошкообразный материал с удельной поверхностью 400 м 2/ кг при следующем соотношении компонентов, мас. %: Известь 6 Кварцевый песок 69 Керамзитовая пыль 25
(4722)55-41-61
 322.  Станок для обработки бандажей и опорных роликов
Станок для обработки бандажей и опорных роликов технологического барабана, содержащий опорные стойки с разрезными головками, в которых установлена направляющая, несущая продольный подвижный суппорт с резцедержателем, отличающийся тем, что он снабжен защитным экраном, выполненным из стального листового материала и установленным на опорных стойках со стороны обрабатываемого барабана.
(4722)55-41-61
 323.  Станок для обработки бандажей и опорных роликов
Станок для обработки бандажей и опорных роликов, имеющий опорные стойки с разрезными головками, в которых установлена направляющая со шпонкой, несущая продольный подвижный суппорт с резцедержателем, отличающийся тем, что направляющая выполнена со шпонкой по всей длине, а продольный суппорт имеет кронштейны с регулировочными винтами, контактирующими с компенсирующими планками, размещенными между кронштейнами и боковыми поверхностями шпонки.
(4722)55-41-61
 324.  Помольно-смесительное устройство периодического действия
Помольно-смесительное устройство периодического действия, состоящее из корпуса с шаровыми мелющими телами и мешалкой, отличающееся тем, что лопасти мешалки выполнены в виде вертикальных скоб разной длины, расположенных на диске, закрепленном на валу, центр расположения лопастей смещен относительно центра диска, лопасти имеют П-образную форму, нижняя сторона лопасти имеет наклон к горизонтали.
(4722)55-41-61
 325.  Способ изготовления полых стеклосфер, сырьевая шихта для изготовления полых стеклосфер
1. Способ изготовления полых стеклосфер, включающий получение микропорошков силикатного стекла с размерами частиц менее 40 мкм, термическое формование полых стеклосфер, разделение их по размеру, отличающийся тем, что в качестве силикатного стекла используют кристаллизованное стекло, совместно молотое с карбонатным газообразователем и оксидом железа, полученные микропорошки перед термическим формованием гранулируют. 2. Сырьевая шихта для изготовления полых стеклосфер, состоящая из микропорошка силикатного стекла, отличающаяся тем, что в качестве силикатного компонента используется кристаллизованное силикатное стекло, молотое совместно с карбонатным газообразователем и оксидом железа и гранулированное при использовании 8-12%-ного водного раствора жидкого стекла при следующем соотношении компонентов, мас. %: карбонатный газообразователь 0, 5-7, 0 оксид железа 0, 5-7, 0 8-12%-ный водный раствор жидкого стекла 1, 0-2, 8 кристаллизованное стекло остальное.
(4722)55-41-61
 326.  Способ изготовления полых стеклосфер, сырьевая шихта для изготовления полых стеклосфер
1. Способ изготовления полых стеклосфер, включающий получение микропорошков силикатного стекла с размерами частиц менее 40 мкм, термическое формование полых стеклосфер, разделение их по размеру, отличающийся тем, что в качестве силикатного стекла используют кристаллизованное стекло, совместно молотое с газовой сажей, полученные микропорошки перед термическим формованием гранулируют. 2. Сырьевая шихта для изготовления полых стеклосфер, состоящая из микропорошка силикатного стекла, отличающаяся тем, что в качестве силикатного компонента используется кристаллизованное силикатное стекло, молотое совместно с газовой сажей и гранулированное при использовании 8-12%-ного водного раствора жидкого стекла при следующем соотношении компонентов, мас. %: газовая сажа 0, 05-2, 5 8-12%-ный водный раствор жидкого стекла 1, 0-2, 8 кристаллизованное стекло остальное .
(4722)55-41-61
 327.  Станок для обработки бандажей
Станок для обработки бандажей, содержащий опорные стойки, продольный суппорт с подпружиненной пинолью, на конце которой шарнирно закреплена роликовая тележка с опорными роликовыми блоками и кареткой со шлифовальной установкой с бесконечной абразивной лентой, отличающийся тем, что станок снабжен сдвоенными продольными и поперечными профильными рельсовыми направляющими качения и механизмом вертикальных и горизонтальных настроечных перемещений.
(4722)55-41-61
 328.  Станок для обработки бандажей
Станок для обработки бандажей, имеющий опорные стойки, в которых установлена направляющая, несущая суппорт, снабженный подпружиненной пинолью, на конце которой шарнирно закреплена роликовая тележка с механизмом осевого перемещения, отличающийся тем, что роликовая тележка снабжена опорными роликовыми блоками, каждый из которых выполнен в виде двух роликов, жестко связанных между собой, шарнирно закрепленных на концах роликовой тележки, и шлифовальной установкой со сменной бесконечной абразивной лентой, закрепленной на механизме осевого перемещения.
(4722)55-41-61
 329.  Дезинтегратор
Дезинтегратор, содержащий корпус с установленными внутри него роторами, отличающийся тем, что под верхним горизонтальным диском на одной оси с загрузочным устройством закреплен с возможностью колебаний многоступенчатый корпус, на нижнем горизонтальном диске на одной оси с многоступенчатым корпусом жестко закреплен многоступенчатый ротор с ударными билами, в нижней части многоступенчатого ротора жестко закреплены разбрасывающие лопатки, при этом кольцевой зазор между внутренней поверхностью многоступенчатого корпуса и описываемым ударными билами диаметром многоступенчатого ротора равен значению a=2 3dmax, а зазор между верхними кромками разбрасывающих лопаток и нижним торцом многоступенчатого корпуса больше значения b=dmax, где dmax - максимальный размер частиц измельчаемого материала.
(4722)55-41-61
 330.  Станок для обработки бандажей и опорных роликов
Станок для обработки бандажей и опорных роликов, содержащий опорные стойки с разрезными головками, в которых установлена направляющая со шпонкой, несущая продольный подвижный суппорт с резцедержателем, отличающийся тем, что он снабжен подпружиненным стружкоотводящим предохранительным желобом, выполненным из стального листового материала и установленным на продольном подвижном суппорте.
(4722)55-41-61
 331.  Способ получения цементного клинкера
(4722)55-41-61
 332.  Передвижной фрезерный станок для обработки торцов крупногабаритных деталей кольцевой формы
(4722)55-41-61
 333.  Помольно-смесительный агрегат с автоматической балансировкой
(4722)55-41-61
 334.  Дезинтегратор
1. Дезинтегратор, содержащий профильный корпус с коаксиально установленными в нем узлами загрузки, измельчения и смешивания, при этом узел измельчения состоит из полого наружного и коаксиально расположенного в нем, выполненного в виде вала внутреннего роторов, при этом наружный ротор состоит из двух частей - верхнего полого вала, заканчивающегося закрепленным на нем диском с рабочими элементами - верхним диском, и нижнего полого вала с закрепленным на его верхней части диском с рабочими элементами - нижним диском; внутренний ротор также имеет в средней части диск с рабочими элементами - средний диск, расположенный между верхним и нижним дисками, при этом верхний и нижний диски охватывают жестко закрепленный на них цилиндр, а на нижней поверхности нижнего диска закреплены лопасти вентилятора; узел загрузки расположен над узлом измельчения и содержит усеченный конус, жестко закрепленный большим основанием, обращенным вверх, на корпусе, а меньшее основание расположено с зазором над верхним диском; при этом нижнюю часть корпуса охватывает жестко закрепленная на ней торообразная смесительная камера, отличающийся тем, что в узле загрузки, внутри усеченного конуса коаксиально установлены, по меньшей мере, два усеченных конуса, жестко связанных с корпусом большими основаниями, обращенными вверх, установленные с зазором один над другим, причем нижнее основание верхнего конуса жестко соединено с верхней частью направляющего кольца, а нижнее основание среднего конуса расположено с зазором относительно коаксиально установленного направляющего кольца, кроме того, боковая поверхность среднего конуса снабжена расположенными в ее центральной части окнами, а боковая поверхность нижнего конуса снабжена окнами, размещенными в ее верхней части, и охвачена усеченным конусом с выпуклой дугообразной боковой поверхностью таким образом, что меньшее основание усеченного конуса с выпуклой дугообразной боковой поверхностью совпадает с верхней частью каждого окна нижнего конуса, кроме того, рабочие элементы верхнего диска наружного ротора расположены на нем по спиралям в несколько рядов, рабочие элементы среднего диска внутреннего ротора расположены в несколько рядов по обеим сторонам диска, причем рабочие элементы, размещенные на верхней части среднего диска, расположены по концентрическим окружностям с относительным зазором между спиралями рабочих элементов верхнего диска, а рабочие элементы нижней части среднего диска расположены на нем по спиралям в несколько рядов, при этом рабочие элементы нижнего диска наружного ротора расположены по концентрическим окружностям с относительным зазором между рабочими элементами нижней части среднего диска, установленных на нем по спиралям, в свою очередь, торообразная смесительная камера узла смешения выполнена в виде цилиндрической камеры и охвачена пустотелым тором, причем в средней части цилиндрической камеры установлен вентилятор, закрепленный на нижней части вала внутреннего ротора и соединенный при помощи патрубка с полостью торообразной смесительной камеры, а между узлом смешения и вентилятором на корпусе последнего размещен обращенный дном к нижнему валу наружного ротора приемный стакан, верхняя часть которого оснащена тангенциально установленным патрубком, а торообразная смесительная камера содержит поперечную перегородку, расположенную между загрузочной воронкой торообразной смесительной камеры и разгрузочным патрубком, разделяющую торообразную смесительную камеру на всасывающий и нагнетающий каналы, при этом всасывающий канал соединен посредством патрубка с вентилятором, а нагнетающий канал снабжен разгрузочным патрубком, кроме того, загрузочная воронка сообщена с всасывающим каналом торообразной смесительной камеры, а тангенциально установленный патрубок приемного стакана и верхнего конуса соединены между собой трубопроводом. 2. Дезинтегратор по п. 1, отличающийся тем, что количество спиралей и рядов рабочих элементов, размещенных на дисках, зависит от физико-механических свойств измельчаемого материала и диаметра дисков наружного и внутреннего роторов. 3. Дезинтегратор по п. 1, отличающийся тем, что может содержать дополнительную торообразную смесительную камеру, закрепленную в верхней части корпуса дезинтегратора, причем камера содержит вертикальную разделительную перегородку и соединена с основной смесительной камерой при помощи трубопровода.
(4722)55-41-61
 335.  Дезинтегратор
Дезинтегратор для измельчения малоабразивных материалов, внутри которого помещены роторы, разгрузочное устройство и привод, отличающийся тем, что дезинтегратор снабжен двумя дополнительными роторами и приводом, все роторы симметрично расположены в спиральном корпусе, принадлежат одной плоскости и выполнены с возможностью вращения внешних рядов ударных элементов в направлении разгрузочного устройства, спиральный корпус имеет прямолинейную стенку, а разгрузочное устройство равноудалено от осей вращения роторов и расположено напротив прямолинейной стенки, к корпусу примыкают два загрузочных устройства для подачи измельчаемых материалов в центры вращения роторов.
(4722) 55-41-61
 336.  Цементная вращающаяся печь с рекуператорными холодильниками
(4722)55-41-61
 337.  Известково-кремнеземистое вяжущее, способ получения известково-кремнеземистого вяжущего и способ получения формовочной смеси для прессованных силикатных изделий
(4722)55-41-61
 338.  Переносной станок для обработки вкладышей крупногабаритных подшипников скольжения
(4722)55-41-61
 339.  Экструдер для переработки полимерных композиционных материалов
(4722)55-41-61
 340.  Устройство бесконтактного мониторинга трещин в строительных конструкциях
(4722)55-41-61
 341.  Устройство для перемешивания материалов
(4722)55-41-61
 342.  Аспирационное укрытие мест перегрузки сыпучего материала
Аспирационное укрытие мест перегрузки сыпучего материала, содержащее корпус, образованный крышкой, двойными боковыми и задними стенками, эластичные уплотнители, закрепленные на стенках корпуса, фартуки, закрепленные на передних и задних стенках корпуса, аспирационную воронку и загрузочный желоб, внутри корпуса между аспирационной воронкой и загрузочным желобом установлена жесткая вертикальная перегородка, отличающееся тем, что внутренняя жесткая перегородка выполнена под углом (50-60 градусов) к крышке укрытия, навстречу движению эжекционного воздуха.
(4722)55-41-61
 343.  Устройство для снижения подсосов воздуха через открытые проемы укрытия
(4722)55-41-61
 344.  Аспирационное укрытие мест перегрузки сыпучего материала
Аспирационное укрытие мест перегрузки сыпучего материала, состоящее из корпуса, образованного крышкой, к которой жестко прикреплены передняя, задняя и боковые стенки, загрузочного желоба, установленного на крышке, внутренних передней, задней и боковых стенок, жестко прикрепленных к крышке и установленных параллельно одноименным стенкам корпуса ограждая пространство под загрузочным желобом, эластичных уплотнителей, закрепленных на боковых стенках корпуса, фартуков, закрепленных на передней и задней стенках корпуса, аспирационной воронки, установленной на крышке непосредственно вблизи загрузочного желоба, дополнительной стенки крышки, отличающееся тем, что дополнительная стенка крышки выполнена в виде двухскатной крыши, расположена под аспирационной воронкой коньком вверх и жестко закреплена торцевой стороной скатов к передней внутренней стенке.
(4722)55-41-61
 345.  Устройство для фрезерования сложнопрофиль-ных поверхностей
(4722)55-41-61
 346.  Гибкая протяжка для обработки отверстий малого диаметра
(4722)55-41-61
 347.  Станочный модуль для восстановительной обработки крупногабаритных тел вращения
(4722)55-41-61
 348.  Способ подготовки стекольной шихты
(4722)55-41-61
 349.  Энергосберегающий зимний сад
(4722)55-41-61
 350.  Система автоматического регулирования отопления здания с учетом его фасадов (ее варианты)
(4722)55-41-61
 351.  Способ обеспечения прямолинейности оси вращающейся печи
(4722)55-41-61
 352.  Смесь для грунтобетона
(4722)55-41-61
 353.  Способ приготовления керамического шликера
(4722)55-41-61
 354.  Способ получения защитно-декоративного покрытия на изделиях из бетона
(4722)55-41-61
 355.  Устройство сушки
(4722)55-41-61
 356.  Шнековый питатель
(4722)55-41-61
 357.  Способ получения покрытий на блочном пеностекле
Способ получения покрытий на блочном пеностекле, включающий подготовку шихты для покрытия, нанесение ее на поверхность пенообразующей смеси, оплавление и контроль качества готовых изделий, отличающийся тем, что оплавление лицевой поверхности блочного пеностекла, предварительно покрытого пастой на основе тонкомолотого боя стекла и жидкого стекла, производят плазменным факелом при мощности работы плазмотрона 9, 0 кВт и скорости прохождения плазменного факела по лицевой поверхности 0, 05 м/ с
(4722)55-41-61
 358.  Смесь для производства мелкозернистого сталефибробетона на основе отсева дробления кварцитопесчаника
(4722)55-41-61
 359.  Классификатор центробежного типа
(4722)55-41-61
 360.  Станок для обработки наружных поверхностей бандажей
(4722)55-41-61
 361.  Дезинтегратор
1. Дезинтегратор для измельчения малоабразивных материалов, включающий корпус, внутри которого помещены роторы, патрубок отвода измельченного материала и приводы, отличающийся тем, что патрубок отвода измельченного материала имеет спиралеобразную форму постоянной кривизны и тангенциально соединен на уровне выхода исходного материала из загрузочной течки с загрузочно-классификационным узлом, расположенным в верхней части дезинтегратора и включающим загрузочную течку, неподвижный бункер с выхлопной трубой для отвода готового продукта, а также жестко закрепленные на верхнем вращающемся роторе центральный конус и разгонные патрубки для грубого и тонкого продукта, при этом вращающиеся роторы, центральный конус, разгонные патрубки и выхлопная труба расположены на одной вертикальной оси. 2. Дезинтегратор по п. 1, отличающийся тем, что патрубок отвода измельченного материала имеет отводной канал для аэрации материала, подаваемого на измельчение через загрузочную течку.
(4722)55-41-61
 362.  Композит для защиты от космического воздействия, способ его получения
(4722)55-41-61
 363.  Передвижной фрезерный станок для обработки торцов крупногабаритных деталей кольцевой формы
(4722)55-41-61
 364.  Устройство для перемешивания материалов
(4722)55-41-61
 365.  Устройство возврата клинкерной пыли в холодильник
(4722)55-41-61
 366.  Вращающаяся цементная печь
Вращающаяся цементная печь, содержащая уплотнительное устройство лепесткового типа, закрепленного на корпусе холодильной камеры, отличающаяся тем, что она снабжена вертикальным трубопроводом с заслонкой, имеющей регулируемые грузы открытия и закрытия заслонки.
(4722)55-41-61
 367.  Способ измельчения цементной сырьевой смеси
(4722)55-41-61
 368.  Способ изготовления керамических форм по растворяемым моделям для получения точных отливок
(4722)55-41-61
 369.  Способ изготовления стеновых керамических изделий (варианты)
(4722)55-41-61
 370.  Биореактор барботажного типа
(4722)55-41-61
 371.  Мешалка-кристаллизатор периодического действия
(4722055-41-61
 372.  Устройство для переработки жидких шлаков
(4722)55-41-61
 373.  Конденсационный водогрейный котел
(4722)55-41-61
 374.  Станок для обработки бандажей и опорных роликов
Станок для обработки бандажей и опорных роликов, имеющий опорные стойки с разрезными головками, в которых установлена направляющая со шпонкой, несущая продольный подвижной суппорт с резцедержателем, отличающийся тем, что продольный подвижной суппорт содержит две базовые плоскости, расположенные под углом 90 градусов, для установки поперечного суппорта, причем верхняя плоскость расположена под углом 46 градусов относительно вертикальной оси, снабжен сменными вкладышами, установленными с двух сторон в центральной расточке и выполнен разрезным, с возможностью регулирования зазора в направляющих.
(4722)55-41-61
 375.  Пресс для отжима жидкостей и масел
(4722)55-41-61
 376.  Композиционное вяжущее
(4722)55-41-61
 377.  Способ переработки шламов гальванических производств
(4722)55-41-61
 378.  Смесь для производства мелкозернистого бетона
(4722)55-41-61
 379.  Помольно-смесительный агрегат
1. Помольно-смесительный агрегат, содержащий станину, загрузочный бункер, вертикальные направляющие, помольные камеры, соединенные между собой патрубками с окнами и размещенными на рамках, каждая их которых связана верхней частью посредством ползунов с направляющими, а нижний-с эксцентриковыми валами, имеющими противовесы и размещенные в опорных стойках, закрепленных на станине, отличающийся тем, что помольно-смесительный агрегат снабжен промежуточным валом, установленным в опорах станины с возможностью одновременного кинематического взаимодействия с парой эксцентриковых валов, каждый из которых связан с соответствующей рамой, причем эксцентриковые валы размещены параллельно промежуточному валу, противонаправленно друг другу с возможностью изменения относительного угла установки, а противовесы эксцентриковых валов выполнены регулируемыми, при этом загрузочный бункер выполнен двухсекционным, снабжен горизонтальными заслонками и каждая из секций соединена с патрубком соответствующей помольной камеры. 2. Помольно-смесительный агрегат по п. 1, отличающийся тем, что угол установки эксцентриковых валов обеспечивается с помощью цилиндрических зубчатых колес промежуточного вала и составляет 170 градусов < = альфа < = 190 градусов.
(4722)55-41-61
 380.  Устройство для регенерации энергии в установке техники кондиционирования и вентиляции
(4722)55-41-61
 381.  Способ подготовки огнеупорных порошков для изготовления керамических форм
(4722)55-41-61
 382.  Состав грунтобетонной смеси, грунтобетонное основание дорожной одежды, способ его устройства
(4722)55-41-61
 383.  Способ переработки шламов гальванического производства
(4722)55-41-61
 384.  Роторно-пульсационный комплекс для производства пенобетона
(4722)55-41-61
 385.  Чистящая головка лезвийная
(4722)55-41-61
 386.  Стеновой брус
(4722)55-41-61
 387.  Способ адаптивного трехпозиционного регулирования
(4722)55-41-61
 388.  Способ тонкого измельчения сырья, преимущественно цементного клинкера, в шаровой барабанной мельнице
(4722)55-41-61
 389.  Адаптивный трехпозиционный регулятор
(4722)55-41-61
 390.  Линия глубокой очистки и переработки животноводческих стоков.
(4722)55-41-61
 391.  Пресс-валковый агрегат с устройством для подачи анизотропных материалов
(4722)55-41-61
 392.  Моделирование случайных процессов распределения энергии в системе проектирования подпорных стен
(4722)55-41-61
 393.  Программа для определения линейных размеров объекта с использованием конвертации цветного изображения в монохромное
(4722)55-41-61
 394.  Адаптивная система электронного обучения
(4722)55-41-61
 395.  Адаптивная тестирующая web-система
(4722)55-41-61
 396.  Программа адаптивного трехпозиционного способа управления температурой для модуля Н60С-М1
(4722)55-41-61
 397.  Программа для распознавания меток с использованием видеоизображения
(4722)55-41-61
 398.  Проектирование подпорных стен с исключением ограничений зависимых переменных
(4722)55-41-61
 399.  Программа распознавания геометрической формы объектов на двумерных изображениях
(4722)55-41-61
 400.  Программа управления двумя мобильными роботами по беспроводному Wi-Fi интерфейсу
(4722)55-41-61
 401.  HControl – программа оптимального управления низкотемпературными гелиоустановками активного типа
(4722)55-41-61
 402.  Программа управления шаровыми кранами установки улавливания легких фракций нефти
(4722)55-41-61
 403.  Программа расчета параметров схемы замещения асинхронного двигателя
(4722)55-41-61
 404.  Автоматизированная система для прогнозирования курсов валют
(4722)55-41-61
 405.  Тестирование программ на основе эталонных данных
(4722)55-41-61
 406.  Определение оптимального пути передвижения объекта с заданными ограничениями
(4722)55-41-61
 407.  Редактор синтаксических диаграмм
(4722)55-41-61
 408.  Программа для управления, мониторинга и диспетчеризации систем производственного здания на основе протокола обмена данными Z-WAVE
(4722)55-41-61
 409.  Система для решения теоретико-множественных уравнений
(4722)55-41-61
 410.  Доказательство теоретико-множественных тождеств и включений
(4722)55-41-61
 411.  Программа для логического управления дискретными процессами
(4722)55-41-61
 412.  Приложение для моделирования бинарных индикаторных сетей
(4722)55-41-61
 413.  Система планирования закупок одномерного материала
(4722)55-41-61
 414.  Программа определения параметров управляющего сигнала в автоматизированной системе управления источниками звуковых сигналов с высокой скоростью нарастания
(4722)55-41-61
 415.  Пропускная способность участка улично-дорожной сети в зависимости от дорожных условий
(4722)55-41-61
 416.  Программа расчета параметров системы отопления здания с автоматизированным индивидуальным тепловым пунктом
(4722)55-41-61
 417.  Программа сбора и регистрации параметров распределенных объектов
(4722)55-41-61
 418.  Программа распределенной информационной системы мониторинга выбросов загрязняющих веществ
(4722)55-41-61
 419.  Интерактивная система диагностики сложных объектов, позволяющая исключить неоднородность принятия решения
(4722)55-41-61
 420.  Оптимальные методы расчета подпорных стен
(4722)55-41-61
 421.  Программа для моделирования динамики экстремальных систем управления объектов промышленности строительных материалов
(4722)55-41-61
 422.  Программа анализа состояния монокристалла искусственного сапфира на этапе затравления в тигле ростовой установки
(4722)55-41-61
 423.  Способ получения пенобетонной смеси с использованием механоактивированного вяжущего
(4722)55-41-61
 424.  Установка для измельчения волокнистых материалов
(4722)55-41-61
 425.  Силикатная краска
(4722)55-41-61
 426.  Кожухотрубный теплообменный аппарат
(4722)55-41-61
 427.  Газовая горелка для бытовых газовых плит
(4722)55-41-61
 428.  Смеситель
(4722)55-41-61
 429.  Устройство для пневмомеханического гранулирования техногенных материалов
(4722)55-41-61
 430.  Устройство для сбора нефтепродуктов с поверхности воды
(4722)55-41-61
 431.  Аэрационный узел флотационной машины
(4722)55-41-61
 432.  Электрод-инструмент для электрофизической и электрохимической обработки глубоких отверстий малого диаметра
(4722)55-41-61
 433.  Опора вращающейся обжиговой цементной печи
(4722)55-41-61
 434.  Установка для гомогенизации глиномасс
(4722)55-41-61
 435.  Способ демеркуризации люминесцентных ламп
(4722)55-41-61
 436.  Дезинтегратор
Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным патрубками и с размещенными в цилиндрическом корпусе с возможностью встречного вращения верхним и нижним горизонтальными дисками с закрепленными по концентрическим окружностям ударными элементами, каждый из которых расположен между ударными элементами противолежащего диска, на выходе осевого загрузочного патрубка под углом к верхнему горизонтальному диску установлены разбрасывающие патрубки, изогнутые в направлении, противоположном направлению вращения верхнего диска, причем на конце каждого из разбрасывающих патрубков закреплен диффузор, больший диаметр D которого равен (0, 6-0, 8) h, где h - высота ударных элементов, м, а угол наклона α разбрасывающих патрубков к верхнему горизонтальному диску больше угла естественного откоса измельчаемого материала, при этом расстояние а между торцами диффузоров и ударными элементами превышает максимальный размер измельчаемых частиц, на нижнем горизонтальном диске под разбрасывающими патрубками установлено устройство для равномерного распределения материала по периметру рабочей камеры, отличающийся тем, что на нижней плоскости схождения разбрасывающих патрубков соосно с загрузочным патрубком расположена горизонтальная просеивающая поверхность, диаметр которой равен внутреннему диаметру загрузочного патрубка, имеющая концентрические ряды отверстий с диаметром отверстия 5… 10 d, где d – размер готового продукта.
(4722)55-41-61
 437.  Роторная дробилка
(4722)55-41-61
 438.  Аспирационное укрытие места перегрузки сыпучего материала
Аспирационное укрытие, содержащее загрузочную трубу, верхний короб укрытия, нижний короб укрытия, фартуки, эластичные уплотнения, приемную камеру, байпасную камеру, аспирационную воронку, отличающиеся тем, что байпасная камера образована соосно расположенными загрузочной трубкой и цилиндрической стенкой наружной трубы, а загрузочная труба имеет перфорацию.
(4722)55-41-61
 439.  Гранулированный композиционный заполнитель на основе опоки для бетонных строительных изделий и бетонное строительное изделие
(4722)55-41-61
 440.  Гранулированный композиционный заполнитель на основе диатомита для бетонной смеси и бетонное строительное изделие
(4722)55-41-61
 441.  Мелкозернистый цементобетон на основе модифицированного базальтового волокна
(4722)55-41-61
 442.  Автоматическая система управления движением транспортного средства
(4722)55-41-61
 443.  Дезинтегратор
(4722)55-41-61
 444.  Пресс-валковый измельчитель для получения кубовидного материала
(4722)55-41-61
 445.  Способ получения блочного термостойкого пеностекла
(4722)55-41-61
 446.  Дезинтегратор
Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным патрубками и с размещенными в цилиндрическом корпусе с возможностью встречного вращения верхним и нижним горизонтальными дисками с закрепленными по концентрическим окружностям ударными элементами, каждый из которых расположен между ударными элементами противолежащего диска, на выходе осевого загрузочного патрубка под углом к верхнему горизонтальному диску установлены разбрасывающие патрубки, изогнутые в направлении, противоположном направлению вращения верхнего диска, причем на конце каждого из разбрасывающих патрубков закреплен диффузор, больший диаметр D которого равен (0, 6-0, 8)h, где h - высота ударных элементов, а угол наклона разбрасывающих патрубков к верхнему горизонтальному диску больше угла естественного откоса измельчаемого материала, при этом расстояние а между торцами диффузоров и ударными элементами превышает максимальный размер измельчаемых частиц, а на нижнем горизонтальном диске под разбрасывающими патрубками установлено устройство для равномерного распределения материала по периметру рабочей камеры, отличающийся тем, что на разбрасывающих патрубках жестко закреплен вертикальный цилиндр с отбойными плитами, установленными спиралевидно в четырех секторах окружности, при этом наружный радиус кривизны отбойных плит в поперечном сечении увеличивается обратно вращению вертикального цилиндра в каждом секторе от минимального до максимального, а минимальное расстояние amin между отбойными плитами и ударными элементами первого внутреннего ряда превышает максимальный размер измельчаемых частиц dmax.
(4722)55-41-61
 447.  Дезинтегратор
Дезинтегратор, содержащий цилиндрический корпус с осевым загрузочным и тангенциальным разгрузочным патрубками, в котором друг над другом соосно размещены с возможностью встречного вращения горизонтальные диски с рядами ударных элементов, каждый из них расположен между соседними ударными элементами противолежащего диска, отличающийся тем, что на вертикальном стакане, принадлежащем нижнему горизонтальному диску, жестко закреплен конический лопастной разбрасыватель, расположенный на одной оси с осевым загрузочным патрубком и имеющий диаметр основания конуса, равный диаметру отверстия осевого загрузочного патрубка, к осевому загрузочному патрубку жестко прикреплен отбойный усеченный конус, основания конического лопастного разбрасывателя и отбойного усеченного конуса направлены навстречу друг другу, а образующие пересекаются под углом 90° в точках, принадлежащих диаметру основания отбойного усеченного конуса, при этом на вертикальном стакане жестко закреплены вертикальные разбрасывающие лопатки, диаметр описываемой окружности которых меньше внутреннего диаметра первого ряда ударных элементов на 2dmax, где dmax – максимальный размер частиц материала.
(4722)55-41-61
 448.  Быстросоединительное устройство
(4722)55-41-61
 449.  Зубчато-планетарный вибровозбудитель
(4722)55-41-61
 450.  Ручная кромкофрезерная машина
(4722)55-41-61
 451.  Фасадная термопанель
(4722)55-41-61
 452.  Центробежный дисковый измельчитель
(4722)55-41-61
 453.  Устройство для получения биогаза при анаэробной ферментации органических отходов
(4722)55-41-61
 454.  Передвижной фрезерный станок для обработки торцов крупногабаритных деталей кольцевой формы
В рамках договорных отношений
(4722)55-41-61
 455.  Устройство для перемешивания материалов
(4722)55-41-61
 456.  Способ направленного инерционного вибровозбуждения и дебалансный вибровозбудитель направленного действия для его осуществления
(4722)55-41-61
 457.  Многоступенчатый барботажный экстрактор
(4722)55-41-61
 458.  Конденсационный водогрейный котел
(4722)55-41-61
 459.  Вертикальный автоклав
(4722)55-41-61
 460.  Устройство для обработки бандажей
Устройство для обработки бандажей, содержащее силовой стол и поворотный куб, на котором установлен суппорт, отличающееся тем, что оно оснащено рамой с установленными на ней двумя опорными роликами, системой горизонтальных упоров и приводом вращения одного из опорных роликов, при этом силовой стол и поворотный куб закреплены на раме.
(4722)55-41-61
 461.  Планетарный смеситель
(4722)55-41-61
 462.  Пресс-валковый агрегат
(4722)55-41-61
 463.  Способ направленного инерционного вибровозбуждения и дебалансный вибровозбудитель направленного действия для его осуществления
(4722)55-41-61
 464.  Устройство для определения отклонения оси крупногабаритного вращающегося объекта
(4722)55-41-61
 465.  Аспирационное укрытие мест перегрузки сыпучего материала
1. Аспирационное укрытие мест перегрузки сыпучего материала, содержащее короб, образованный торцевыми стенками, крышкой и боковыми стенками, расположенными под внутренним углом наклона менее 90 градусов к верхней крышке, эластичные уплотнители, фартуки, закрепленные на торцевых стенках корпуса, аспирационную воронку и загрузочный желоб, отличающийся тем, что крышка содержит обтекатель, установленный у загрузочного желоба. 2. Аспирационное укрытие по п. 1, отличающееся тем, что дополнительно содержит разделитель потока, образующий с обтекателем щелевое сопло на выходе из загрузочного желоба.
(4722)55-41-61
 466.  Композит для защиты от космической радиации
(4722)55-41-61
 467.  Барботажный экстрактор
(4722)55-61-41
 468.  Колонна для жидкостной экстракции
(4722)55-61-41
 469.  Гидроизоляционная полимербитумная эмульсионная мастика
(4722)55-61-41
 470.  Пневмокамерный насос для транспортировки сыпучих материалов
(4722)55-61-41
 471.  Состав шихты для изготовления композиционных микрошариков, способ ее получения
(4722)55-61-41
 472.  Противоточный пневмосмеситель для производства дисперсно-армированных смесей
(4722)55-41-61
 473.  Гранулированный наноструктурирующий заполнитель на основе высококремнеземистых компонентов для бетонной смеси, состав бетонной смеси для получения бетонных строительных изделий (варианты) и бетонное строительное изделие
(4722)55-41-61
 474.  Способ регулирования параметров горения газообразного топлива
(4722)55-61-41
 475.  Дезинтегратор
(4722)55-41-61
 476.  Гранулированный композиционный заполнитель на основе силикатных стеновых изделий на основе трепела и силикатное стеновое изделие
(4722)55-41-61
 477.  Барабанно-винтовой СВЧ сушильный агрегат непрерывного действия для сушки сыпучих и гранулированных материалов
(4722)55-41-61
 478.  Сырьевая смесь для ячеистых изделий автоклавного твердения
(4722)55-41-61
 479.  Гранулированный композиционный заполнитель для силикатных стеновых изделий на основе кремнистых цеолитовых пород и силикатное стеновое изделие
(4722)55-41-61
 480.  Теплоизоляционно-конструкционная кладочная смесь на основе легкого заполнителя
(4722)55-41-61
 481.  Резистивный композит
(4722)55-41-61
 482.  Одновальный планетарный вибратор направленных колебаний
(4722)55-41-61
 483.  Адаптивный инструментальный модуль
Адаптивный инструментальный модуль, содержащий корпус, инструментальный блок с резцедержателем, несущим резец, механизм поперечного перемещения инструментального блока, имеющий прецизионную шариковинтовую передачу, связанную с серводвигателем, передаточный механизм качания резцедержателя и устройство управления, содержащее сервоприводы, контроллер и устройство отображения и программирования, при этом все серводвигатели связаны с устройством управления через сервоприводы, управляемые контроллером, имеющим обратную связь с устройством отображения и программирования и датчиком Холла, через усилитель и аналогово-цифровой преобразователь, а блок питания соединен с сервоприводами, контроллером и аналогово-цифровым преобразователем, отличающийся тем, что в корпусе установлен подвижный стакан, в котором размещен инструментальный блок, и связанный с механизмом поперечного перемещения через шариковинтовую передачу, а резцедержатель закреплен с возможностью качания в вертикальной плоскости на оси и связан с серводвигателем передаточного механизма, взаимодействующим с ним, через зубчатую передачу и коленчатый вал.
(4722)55-41-61
 484.  Система регулирования температуры электронагрева
(4722)55-41-61
 485.  Нечеткий адаптивный позиционный способ автоматического управления объектами с дискретными исполнительными устройствами
В рамках договорных отношений
(4722)55-41-61
 486.  Стенд для определения напряжений и деформаций, возникающих в местах фиксации быстросоединительного устройства
(4722)55-41-61
 487.  Статический смеситель
(4722)55-41-61
 488.  Способ получения минерального порошка для асфальто-бетонной смеси
(4722)55-41-61
 489.  Прицепной дорожный каток
(4722)55-41-61
 490.  Переносной сверлильный станок
(4722)55-41-61
 491.  Аспирационное укрытие места выгрузки сыпучих материалов
В рамках договорных отношений
(4722)55-41-61
 492.  Станок для гибки труб
(4722)55-41-61
 493.  Самоходный дорожный каток
(4722)55-41-61
 494.  Шнек-сепаратор для обезвоживания волокнистого материала
(4722)55-41-61
 495.  Способ управления отрывом воздушного потока на входе во всасывающие каналы
(4722)55-41-61
 496.  Устройство разогрева органических и синтетических продуктов в емкостях
(4722)55-41-61
 497.  Отделочная смесь
(4722)55-41-61
 498.  Социально-технологическая модель оптимизации управления
(4722)55-41-61
 499.  Система обслуживания в социальной сфере
(4722)55-41-61
 500.  Автоматизированная система формирования и ведения медицинских стандартов
(4722)55-41-61
 501.  Методика оценки остаточного ресурса транспортных и технологических машин
(4722)55-41-61
 502.  Способ автоматизированной фотосъемки транспортных средств в процессе технического осмотра
(4722)55-41-61
 503.  Технология организации многоуровневого процесса открытого образования в высшей школе
(4722)55-41-61
 504.  Гуманитарная технология создания культурного ландшафта городской среды
(4722)55-41-61
 505.  Методика оценки инновационной активности предприятия
(4722)55-41-61
 506.  Методика проектирования и построения системы партнерских отношений между предприятиями реального сектора экономики и научно-образовательными организациями региона
(4722)55-41-61
 507.  Метод создания разверток к архитектурным и градостроительным макетам по фотографиям с использованием программы для моделирования трехмерных объектов SketchUp
(4722, )55-41-61
 508.  Методика оценки конкурсного вариантного проектирования архитектурных и градостроительных объектов
(4722)55-41-61
 509.  Собиратель для флотационного обогащения окисленных кварцитов
(4722)55-41-61
 510.  Способ получения искусственных пористых заполнителей для бетонов на основе золошлаковых отходов Черепетской ГРЭС ОАО ИНТЕР РАО – Электрогенерация
(4722)55-41-61
 511.  Технология нанотрибологического диагнос-тирования герметизации сопряженных элементов узлов и агрегатов грузовых транспортных средств
(4722)55-41-61
 512.  Способ изготовления элементов зонирования архитектурной среды из листовых материалов
(4722)55-41-61
 513.  Способ определения параметров транспортного потока для организации движения
(4722)55-41-61
 514.  Вяжущее для приготовления горячих органоминеральных смесей
(4722)55-41-61
 515.  Устройство для выравнивания скорости потока среды в трубе прямоугольного сечения
(4722)55-41-61
 516.  Электронная социальная корпорация жителей территории
(4722)55-41-61
 517.  Методика управления имиджем вуза
(4722)55-41-61
 518.  Фунгицидный модификатор минеральных строительных композиций
(4722)55-41-61
 519.  Система взаимодействия с клиентами производственной компании с модулем защищенного информационного обмена
(4722)55-41-61
 520.  Шестиосевая координатноизмерительная машина
(4722)55-41-61
 521.  Способ получения покрытий на блочном пеностекле
Способ получения покрытий на блочном пеностекле, включающий нанесение порошка глазури на лицевую поверхность блочного пеностекла, его расплавление и контроль качества готовых изделий, отличающийся тем, что порошок глазури подают порошковым питателем в плазменную горелку плазматрона и плазменное напыление порошка глазури производят при мощности плазматрона 10 кВт и скорости прохождения плазменной горелки 0, 1 м/ с и расходе порошка глазури 3, 00-3, 25 г/ с.
(4722)55-41-61
 522.  Установка для измельчения волокнистых материалов
(4722)55-41-61
 523.  Состав закладочной смеси
(4722)55-41-61
 524.  Гранулированный композиционный заполнитель для силикатных стеновых изделий на основе перлита, состав сырьевой смеси для изготовления силикатных стеновых изделий, способ получения силикатных стеновых изделий и силикатное стеновое изделие
(4722)55-41-61
 525.  Станочный модуль для восстановительной обработки бандажей и роликов
(4722)55-41-61
 526.  Способ получения алюмосиликатных огнеупорных изделий
(4722)55-41-61
 527.  Устройство для перемешивания материалов
(4722)55-41-61
 528.  Программа расчета установившегося режима электрической системы (RS-3)
(4722)55-41-61
 529.  Шаровая барабанная мельница с разгрузочным устройством
(4722)55-41-61
 530.  Устройство для отделочно-упрочняющей обработки
(4722)55-41-61
 531.  Способ очистки сточных вод от эмульгированных нефтепродуктов
(4722)55-41-61
 532.  Вяжущее
1. Вяжущее, содержащее цемент, минеральную добавку, отличающееся тем, что в качестве минеральной добавки используют молотые с удельной поверхностью не менее 660 кв. м/ кг кремнистые породы в виде опоки при следующем содержании компонентов: цемент (ЦЕМ 1 ГОСТ 31108-2003), ЗАО Белгородский цементный завод Кремнистая порода в виде опоки - 75-90%. 2. Вяжущее по п. 1, отличающееся тем, что кремнистые породы в виде опоки предварительно перед смешиванием с клинкерным составляющем подвергают термической обработке.
(4722)55-41-61
 533.  Пресс-валковый агрегат
(4722)55-41-61
 534.  Помольно-смесительный агрегат с автоматической балансировкой
(4722)55-41-61
 535.  Пресс-валковый измельчитель для получения кубовидного материала
(4722)55-41-61
 536.  Программа бесконтактного измерения диаметра цилиндрической заготовки
(4722)55-41-61
 537.  Система оперативного контроля работы и теплового анализа режимов работы конденсатного котла
(4722)55-41-61
 538.  Система прогнозирования строительного мониторинга и контроля технического состояния и надежности оснований, фундаментов
(4722)55-41-61
 539.  Программа сбора и регистрации значений переменных распределенных технологических параметров
(4722)55-41-61
 540.  CVMonitor – Программа распознавания изображений для оценки параметров процесса обжига во вращающейся печи
(4722)55-41-61
 541.  Адаптивный инструментальный модуль
(4722)55-41-61
 542.  Композит для защиты от космического воздействия, способ его получения
(4722)55-41-61
 543.  Бетоносмеситель
(4722)55-41-61
 544.  Запорное устройство для перекрытия трубопроводов
8 (3952)40-50-18
 545.  Запорное устройство для перекрытия трубопроводов
8 (3952)40-50-18
 546.  Дробеметное устройство
8 (3952)40-50-18
 547.  Гидравлическое демпфирующее устройство двухстороннего действия
8 (3952)40-50-18
 548.  Гибкий тяговый орган рудничной подъёмной установки
8 (3952)40-50-18
 549.  Взрывораспорный анкер
8 (3952)40-50-18
 550.  Валковая дробилка
8 (3952)40-50-18
 551.  Валец дорожного катка
8 (3952)40-50-18
 552.  Быстросъемный глушитель
8 (3952)40-50-18
 553.  Аппарат для обработки зернистого материала жидкостью
8 (3952)40-50-18
 554.  Устройство для разрушения негабаритов горных пород и прочных строительных материалов
8 (3952)40-50-18
 555.  Программа управления энергетическим режимом электролизеров при производстве алюминия Перегрев
8 (3952)40-50-18
 556.  Программа синтеза алгоритмов управления движением многомассовых мехатронных систем с учетом упругости исполнительных механизмов
8 (3952)40-50-18
 557.  Программа автоматизированного решения краевой задачи для вырожденных систем линейных интегро-дифференциальных уравнений методом наименьших квадратов
8 (3952)40-50-18
 558.  Устройство загрузки и выгрузки камер высокого давления
8 (3952)40-50-18
 559.  Устройство для перекрытия трубопроводов
8 (3952)40-50-18
 560.  Устройство для очистки газов от пыли
8 (3952)40-50-18
 561.  Устройство для диагностики усталостных трещин в стальных трубах стрелы экскаватора
8 (3952) 40-50-18
 562.  Радиально-поршневой насос с фазовым регулированием подачи
8 (3952)40-50-18
 563.  Гидроучасток для разработки угольных пластов с подземным замкнутым циклом водоснабжения
Изобретение относится к горному делу и может быть использовано при подземной гидравлической технологии добычи угля. На гидроучастке для разработки угольных пластов с подземным с замкнутым циклом водоснабжения, вскрывающие и подготавливающие выработки проходят спаренными и/ или одиночными забоями, которые оконтуривают выемочные блоки, барьерные и охранные целики. Подачу воды в забои осуществляют насосными станциями после ее очистки на обезвоживающих комплексах, в механизированных отстойниках и/ или водосборниках, которые располагают в связанных между собой камерах, находящихся в нижних точках выемочного блока гидроучастка и имеющих выход в аккумулирующие выработки, по которым осуществляют гидротранспорт и отгрузку горной массы. Оставленные целики погашают после отработки запасов выемочного блока обратным ходом двухсторонними или односторонними заходками. Очистку воды производят в механизированных отстойниках и/ или водосборниках с применением комбинации технических средств и способов очистки технологической воды, например водонепроницаемые перегородки с перепуском воды у дна, тонкослойные осветлители типа жалюзи и продольные, флотация, коагуляция, электрообработка воды постоянным пульсирующим током и др. Изобретение позволяет локально отрабатывать на пластах запасы со сложными горно-геологическими условиями залегания пластов и снизить материальные затраты.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 564.  Комплексный способ переработки отходов обогащения железных руд
Изобретение относится к области переработки вторичных ресурсов и может быть использовано при обогащении отходов железорудных и других материалов на обогатительных фабриках. Комплексный способ переработки отходов обогащения железных руд включает дробление отходов, отделение магнитных пород магнитными сепараторами, отделение и переработку тяжелых пород, отделение и переработку легких и немагнитных пород, отделение и переработку размокаемых пород. Переработку отходов производят в два этапа: на первом сухом этапе производят первичное отделение магнитных пород магнитными сепараторами барабанного типа, немагнитные породы разделяют на классификаторе на класс крупностью 2, 0 мм и передают его на дробление, где его измельчают и сбрасывают на ленточный транспортер и смешивают с классом крупностью -2, 0 мм после классификатора и проводят вторичное отделение магнитных пород магнитными сепараторами барабанного типа, которые направляют на переработку и брикетирование. Немагнитные породы передают на второй гидравлический этап переработки, для чего их сбрасывают в вибрационный желоб, установленный с уклоном, куда подают воду, и в созданной пульпе гравитационно разделяют немагнитные породы по плотности и крупности частиц, для чего гидравлический поток равномерно увеличивают по высоте в вибрационном желобе. Дифференцированный поток направляют в приемные воронки с отводящими обезвоживающими желобами, установленными с углами естественного откоса, для перепуска обезвоженных сыпучих пород в обезвоживающие бункеры с питателями, откуда обезвоженные породы периодически подают в аппараты Кнельсона, в которых разделяют частицы пород на тяжелые, благородные и редкоземельные, шлихи которых отгружают для аффинажной обработки. Пустую породу из аппаратов, воду из обезвоживающих бункеров и желобов и поток, не уловленный воронками, подают в головную часть обезвоживающего комплекса, где производится осаждение, выдача и обезвоживание твердых частиц в обезвоживающий бункер песка, откуда ее подают для затаривания. Неосевшие частицы вместе с размокаемыми коллоидными частицами переливом уходят в головную часть аккумулирующего обезвоживающего комплекса, где их отстаивают, выдают, частично обезвоживают и используют в виде глины. Осветленная вода шламовым насосом возвращается в головную часть второго этапа. Недостаток воды в замкнутом цикле водоснабжения второго этапа восполняют из внешнего источника. Технический результат - повышение эффективности выделения полезных компонентов из отходов обогащения.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 565.  Способ вольтамперометрического определения фенола в воде и водных объектах
Изобретение относится к электроаналитической химии и может быть использовано для анализа питьевой, поверхностной воды и других водных объектов. Способ вольтамперометрического определения фенола в воде и водных объектах с помощью трехэлектродной системы, включающий предварительную модифицирующую электрохимическую обработку стеклоуглеродного индикаторного электрода системы, проведение измерений концентрации фенола в воде, включающих электрохимическое осаждение фенола на модифицированную поверхность индикаторного электрода из анализируемой воды, последующее электроокисление фенола при изменении потенциала индикаторного электрода, регистрацию на вольтамперной кривой аналитического сигнала, идентификацию пика фенола на вольтамперной кривой и определение концентрации фенола по величине пика фенола, характеризующийся тем, что предварительную модифицирующую электрохимическую обработку индикаторного электрода проводят в водном растворе 0, 2 М сульфата аммония с добавлением ацетона в соотношении объемных частей 19: 1, соответственно. Способ, в котором в качестве электродов измерительной системы: индикаторного, сравнения и вспомогательного электродов используют идентичные стеклоуглеродные стержневые электроды, и в котором при предварительной модифицирующей электрохимической обработке индикаторного электрода проводят также обработку поверхности электрода сравнения и вспомогательного электрода в водном растворе 0, 1 М гидроксида калия с добавлением ацетона в соотношении объемных частей 19: 1, соответственно.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 566.  Способ подготовки шахматистов
Изобретение относится к области психофизиологии и педагогики спорта, а именно к методам тренировки спортсменов, занимающихся шахматами. Задачей изобретения является создание более эффективного способа подготовки шахматистов, в котором спортсмены управляют вниманием, что влияет на качество игры, и приводит в конечном итоге к повышению мастерства шахматиста. Способ подготовки спортсменов, включающий проведение теоретических занятий, изучение методов самонастройки на игру, проведение самонастройки в зависимости от типа нервной системы, отличающийся тем, что выполняют упражнения на управление вниманием, включающие ежедневные упражнения, развивающие концентрацию внимания, а затем проводят тестирование внимания путем проверки отклика с помощью устройства, содержащего манипуляторы типа джойстик для правой и левой рук, содержащих кнопки управления, процессор, содержащий блок памяти и программное средство подсчета времени отклика на нажатие кнопок, а также индикаторную лампочку, по загоранию которой начинают тест, для выполнения которого предъявляют серии сигналов со случайным распределением разных фигур на мониторе, при появлении которых нажимают кнопки на джойстике, и в зависимости от результата тестирования, появляющемся мониторе, судят о готовности к соревнованиям, при этом при времени отклика не более 59-65 секунд делают вывод о хорошей подготовленности.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 567.  Способ регулирования порога инициирования оптического детонатора
Изобретение относится к области технологии производства оптических детонаторов на основе светочувствительного вещества - азида серебра и может быть использовано для регулирования порога срабатывания оптических детонаторов. В соответствии с предложением на азид серебра воздействуют дозированным оптическим излучением путем предварительной обработки азида серебра оптическим излучением длиной волны 380± 10 нм и интенсивностью в пределах 1*10 14 квант/ см2 до 2*1016 квант/ см 2 в течение 5-20 мин. После чего проводят инициирование детонатора энергией оптического излучения выше энергии излучения предварительной обработки. Изобретение обеспечивает более управляемую эксплуатацию детонаторов, позволяет повысить устойчивость кристаллов азида серебра по отношению к термическому, радиационному и фоторазложению и обеспечивает сохранение рабочих характеристик при хранении до года и выше без принятия специальных мер по их сохранности.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 568.  Способ сжигания водоугольной и породной смеси
Изобретение относится к топливно-энергетической промышленности и может быть использовано при утилизации отходов обогащения каменного угля. Способ сжигания водоугольной и породной смеси включает нагрев ее до температуры воспламенения от внешнего источника. В качестве внешнего источника для воспламенения применяют предварительно разогретые стены камеры горения до температуры 1100° C, на которые подают водоугольную и породную смесь, в камеру направляют воздух, обогащенный кислородом на 3-5%, а зону горения подвергают воздействию ультразвуком с частотой 18-25 кГц. Изобретение позволяет утилизировать отходы обогащения угля.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 569.  Способ получения алкенилантрахинонов
Изобретение относится к способу получения алкенилантрахинонов, которые могут найти применение в качестве промежуточных продуктов в синтезе редокс-полимеров, биологически активных веществ и красителей. Способ заключается во взаимодействии 1-иод- или 2-иодантрахинонов с ненасыщенными соединениями, выбранными из группы метилакрилат, метилметакрилат, стирол, в инертной атмосфере в присутствии ацетата палладия, трифенилфосфина и основания. Процесс ведут в присутствии четвертичной аммониевой соли и ацетата натрия в качестве основания в среде диметилформамида при температуре 70-85° С. В качестве четвертичной аммониевой соли используют триэтилбензиламмоний хлорид. Предлагаемый способ позволяет повысить выход целевых алкенилантрахинонов.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 570.  Гидроучасток для разработки угольных пластов с подземным замкнутым циклом водоснабжения
Изобретение относится к горному делу и может быть использовано при подземной гидравлической технологии добычи угля. На гидроучастке для разработки угольных пластов с подземным с замкнутым циклом водоснабжения, вскрывающие и подготавливающие выработки проходят спаренными и/ или одиночными забоями, которые оконтуривают выемочные блоки, барьерные и охранные целики. Подачу воды в забои осуществляют насосными станциями после ее очистки на обезвоживающих комплексах, в механизированных отстойниках и/ или водосборниках, которые располагают в связанных между собой камерах, находящихся в нижних точках выемочного блока гидроучастка и имеющих выход в аккумулирующие выработки, по которым осуществляют гидротранспорт и отгрузку горной массы. Оставленные целики погашают после отработки запасов выемочного блока обратным ходом двухсторонними или односторонними заходками. Очистку воды производят в механизированных отстойниках и/ или водосборниках с применением комбинации технических средств и способов очистки технологической воды, например водонепроницаемые перегородки с перепуском воды у дна, тонкослойные осветлители типа жалюзи и продольные, флотация, коагуляция, электрообработка воды постоянным пульсирующим током и др. Изобретение позволяет локально отрабатывать на пластах запасы со сложными горно-геологическими условиями залегания пластов и снизить материальные затраты.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 571.  Способ определения вероятности возникновения врожденных пороков развития плода у беременных женщин
Изобретение относится к медицине, а именно к медицинской генетике, и может быть использовано для определения вероятности возникновения врожденных пороков развития плода у беременных женщин. Для этого проводят забор крови, определяют путем молекулярно-генетического анализа полиморфизм гена фермента детоксикации GSTT1 в лимфоцитарной ДНК. Затем выявляют путем иммуноферментного анализа антител класса А и G - IgA, IgG, специфичных к бензо[а]пирену Bp, эстрадиолу Es и прогестерону Pg в сыворотке крови, служащих показателями иммунной реакции организма на воздействие тератогенных факторов. При определении повышенных значений соотношений уровней антител IgA Bp/ Es> 2, IgA Bp/ Pg> 2, IgG Bp/ Es> 2, IgG Bp/ Pg> 3 у носителей генотипа GSTT1 0/ 0 делают вывод о высокой индивидуальной чувствительности беременной женщины к действию тератогенных факторов. В связи с этим делают прогноз о высокой вероятности возникновения врожденных пороков развития плода. При определении пониженных значений соотношений уровней антител IgA Bp/ Es< 2, IgA Bp/ Pg< 2, IgG Bp/ Es< 2, IgG Bp/ Pg< 3 у носителей генотипа GSTT1 делают вывод о высокой индивидуальной устойчивости беременной женщины к действию тератогенных факторов. В связи с этим делают прогноз о низкой вероятности возникновения врожденных пороков развития плода. Предложенный способ обеспечивает повышение точности и информативности определения вероятности врожденных пороков.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 572.  Способ оценки индивидуальной чувствительности генома человека к воздействию повышенных доз излучений радона и продуктов его распада
Изобретение относится к области медицины. Предложен способ оценки индивидуальной чувствительности генома человека к воздействию повышенных доз излучений радона и продуктов его распада. В буккальных эпителиоцитах определяют предрасполагающие и протективные генотипы: маркер Arg399Gln гена XRCC1 - предрасполагающий генотип Arg/ Gln, протективный генотип Arg/ Arg; маркер Arg194Trp гена XRCC1 - предрасполагающий генотип Arg/ Trp; маркер Glu185Gln гена NBS1 - предрасполагающий генотип Glu/ Gln, протективный генотип Glu/ Glu; маркер Ser326Cys гена hOGG1 - предрасполагающий генотип Ser/ Cys; маркер Asp1853Asn гена ATM - предрасполагающий генотип Asp/ Asp, протективный генотип Asp/ Asn; маркер Asp1104His гена XPG - протективный генотип His/ His. При преобладании предрасполагающих генотипов или равном количестве предрасполагающих и протективных генотипов делают заключение о высокой индивидуальной чувствительности к действию повышенных доз радона и о прогнозировании накопления микроядер и протрузий. При количественном преобладании протективных генотипов делают заключение о высокой индивидуальной устойчивости к воздействию радона и о прогнозировании устойчивости к накоплению микроядер и протрузий. Предложенный способ позволяет проводить оценку генетически детерминированной предрасположенности к формированию повышенного уровня микроядер и протрузий еще до воздействия радиационного фактора.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 573.  Биоцидная композиция
Изобретение относится к составу биоцидной композиции, применяемой для пропитки бумаги. Композиция содержит пропиленгликоль, крахмал и коллоидное серебро с размером частиц 1-13 нм в концентрации в коллоидном растворе 20-100 ppm при следующем соотношении компонентов, масс. %: пропиленгликоль - 2-4; крахмал - 2-4; коллоидное серебро 2-3; вода остальное до 100. Изобретение позволяет приготовлять экологически безвредную композицию простым способом.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 574.  Способ получения ионообменных полимерных гидрогелей для лечения химических ожогов глаз (варианты)
Изобретение относится к области медицины. Полимерные гидрогели применяют в форме мягких контактных линз (МКЛ), в качестве носителей противоожоговых препаратов. Полимерные гидрогели формируют в виде МКЛ, способных сорбировать обжигающие и токсические вещества в глазах при химических ожогах. Гидрогели получают путем сополимеризации мономеров в присутствии сшивающего агента и смеси равных количеств натриевой и водородной форм ионообменной смолы при выполнении первого варианта. При этом в качестве мономеров используют N-винилпирролидон и метилметакрилат, а в качестве ионообменной смолы слабокислотные карбоксильные катионы марок Д-113, КБ-4 и КБ-2Э, сополимеризацию проводят в присутствии дивинилового диэтиленгликоля под действием ионизирующего γ -излучения до поглощенной дозы 3, 5-4, 5 Мрад. Во втором варианте ионообменную смолу берут в натриевой форме и получают МКЛ, которую используют при кислотных ожогах. В третьем варианте ионообменную смолу берут в водородной форме и получают МКЛ, которую используют при щелочных ожогах глаз. Изобретение обеспечивает получение ионообменных полимерных гидрогелей, обладающих биологической инертностью, кислородной проницаемостью, светопропусканием, пластичностью, упругостью.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 575.  Способ модифицирования чугуна и силумина
Изобретение относится к металлургической промышленности и может быть использовано в литейном производстве для модифицирования чугуна и силумина. Модифицирование металлов выполняют ультрадисперсным порошком (УДП) в виде смеси, содержащей карбидоподобную фазу FeAlCn, оксид алюминия Аl2О3 и гидрооксид алюминия Al(ОН)3 с размером частиц 10 2-103 нм, измельчают смесь в постоянном магнитном поле напряженностью 0, 1-0, 5 Тс и вводят полученный порошок в расплав. Изобретение позволяет повысить качество производимого металла и литейных изделий за счет уменьшения размера частиц порошка-модификатора.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 576.  Способ получения композиционного ультрадисперсного порошка
Изобретение относится к металлургической промышленности, в частности к получению ультрадисперсных порошков. Может использоваться в качестве модификаторов, присадок и раскислителей. Расплав состава, мас. %: алюминий - 26, 0-32, 0, углерод 0, 86-1, 30, железо - остальное, разливают толщиной 1-2 мм по поверхности чугунного листа, охлаждают до комнатной температуры и дробят на куски. Куски помещают в паровую камеру с температурой более 100° С и влажностью 15-20% и выдерживают в течение 1-2 часов. Затем охлаждают до комнатной температуры с получением порошка в виде ультрадисперсных частиц размером 102-103 нм. Способ позволяет упростить технологию получения композиционного наноразмерного порошка и получить порошок, обладающий большой адгезионной способностью к газам в металлических расплавах, вследствие чего имеет модифицирующие свойства для чугунов и силуминов с повышением механической прочности.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 577.  Наноструктурированный агломерат металлического кобальта и способ его получения
Изобретение относится к получению нанопорошков металлического кобальта, в частности его структурированных фрактальных агломератов, имеющих широкий спектр областей применения в виде добавок, существенно влияющих на свойства материалов, в которых они применяются. Способ получения наноструктурированного агломерата металлического кобальта включает взаимодействие растворов соли кобальта общей формулы СоХ2, где Х2 - хлориды, нитраты и/ или сульфаты, с реагентами и восстановлением при повышенной температуре. Перед взаимодействием растворов соли кобальта с реагентами в раствор вводят стабилизирующий агент. В качестве стабилизирующего агента используют тартрат калия-натрия. В качестве реагентов при взаимодействии и восстановлении используют одновременно вводимые щелочь в виде NaOH или KOH, а в качестве редуцирующего агента - гидразингидрат. Техническим результатом является получение новых наноструктурированных фрактальных агломератов металлического кобальта простым способом, в мягких технологических условиях с получением целевого продукта высокой чистоты (99, 9%).
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 578.  Способ получения коагулянта для промышленных сточных вод
Изобретение относится к технологии получения коагулянтов для очистки вод, в частности для очистки промышленных сточных вод с использованием коагулянтов на основе гидрооксихлорида алюминия [Аl2(ОН)nСl6-n]. Получение коагулянта включает добавление соединения железа в водный раствор гидрооксихлорида алюминия, причем в качестве соединения железа используют порошок оксида железа - Fе3O4 с размерами частиц 20-100 нм в концентрации 0, 1-1, 0% от веса водного раствора коагулянта. Изобретение обеспечивает повышение эффективности процессов коагуляции примесей в воде, при этом почти вдвое снижается время коагуляции и повышается степень очистки воды, т. к. снижается количество ионов железа, алюминия и др. примесей до следовых количеств.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 579.  Способ получения нитевидных кристаллов азида серебра
Изобретение относится к технологии выращивания нитевидных кристаллов неорганических соединений и может быть использовано для получения нитевидных монодисперсных кристаллов азида серебра с воспроизводимыми характеристиками. Способ осуществляют путем медленного испарения аммиака из 5% водно-аммиачного раствора мелкокристаллического порошка азида серебра при нормальных условиях в кристаллизаторе через отверстия полиэтиленовой пленки диаметром 0, 5 мм, которой обтягивают кристаллизатор, со скоростью 0, 407 г/ сутки, при этом кристаллизатор с раствором помещают между двумя электродами в бесконтактное электрическое поле напряженностью 100÷ 10-6 В/ см. Варьируя напряженность электрического поля при кристаллизации, можно получать кристаллы различного размера, с минимальным содержанием дефектов, улучшенными рабочими характеристиками (устойчивость к внешним воздействиям - свету, перепаду температур, действию электрического поля, пониженной чувствительностью к удару и трению при сохранении взрывчатых свойств), увеличенным сроком хранения
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 580.  Способ анализа многочастотных сигналов, содержащих скрытые периодичности
Изобретение относится к области обработки информации и измерительной техники, может быть использовано при контроле электротехнических и электромеханических устройств. Способ анализа сигналов выполняют с использованием непрерывных цепных С-дробей путем измерения сигнала в равноотстоящие промежутки времени. Сигнал подают с датчика анализируемых сигналов (ДАС) контролирующего устройства в блок 1 - идентификатор непрерывной цепной С-дроби, в котором последовательно проводят обработку значения сигнала х(k) по определенной формуле до выполнения правила останова с последующим восстановлением прогнозирующей модели сигнала в форме скрытой периодичности. Технический результат заключается в упрощении и ускорении процессов анализа, диагностики, контроля и управления.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 581.  Лечебная физическая культура и массаж: учебное пособие на английском языке для студентов, обучающихся по направлению подготовки: 050100 Педагогическое образование, профиль: 21 Физическая культура и получающих квалификацию бакалавр
База данных представляет собой комплекс методических материалов по предмету Лечебная физическая культура на английском языке для студентов, обучающихся по направлению подготовки: 050100 Педагогическое образование, профиль: 21 Физическая культура и получающих квалификацию бакалавр. База данных содержит теоретическую и практическую части, комплекты контрольно-измерительных материалов. База данных выполнена в мультимедийной форме, навигация осуществляется с помощью гиперссылок. Материал иллюстрирован оригинальными рисунками и фотографиями, сделанными автором. База данных может быть использована для индивидуальной или групповой работы студентов, желающих углубить свои знания по английскому языку параллельно получению профессионального образования.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 582.  Автоматизированная база данных материалов доследственных проверок, уголовных дел и актов судебно-медицинского исследования по убийствам, сопряженных с огнем (Focus)
База данных предназначена органам и лицам, осуществляющим выявление, предупреждение и раскрытие убийств вообще, и, в частности, убийств сопряженных с огнем, а так же для применения в научных и учебных целях. В качестве самостоятельных структурных элементов базы данных выступают следующие разделы: уголовные дела, криминалистическая характеристика, результаты судебно-медицинских исследований, материалы оперативно-розыскных мероприятий, данные оперативно-розыскной деятельности, судебные решения, графика и видеоматериал. База данных позволяет осуществлять: поиск, сортировку, фильтрацию, отбор по заданным условиям, поиск уникальных случаев, статистический анализ и построение математических моделей.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 583.  Расчет оптических характеристик композитов на основе диэлектрика и наночастиц металла
Программа является инструментом для решения уравнения переноса излучения в слое рассеивающей среды с Френелевскими границами методом сферических гармоник на примере распространения света в диэлектрической среде, содержащей наночастицы алюминия, кобальта и никеля. Расчет возможен для любого диэлектрика и реализован для тетранитропентаэритрита (ТЭНа). Программа предназначена исследователям и преподавателям, специализирующимся в области физики и химии. Программа позволяет рассчитывать: реальные коэффициенты эффективности поглощения и рассеяния наноразмерных включений задаваемого радиуса и материала в ТЭНе при облучении образца светом длиной волны 400 ÷ 1200 нм; зависимости коэффициентов поглощения, пропускания и рассеяния света наночастицами металла от толщины образца и концентрации включений в композитах ТЭН-металл; интенсивности углового распределения излучения на границе композита ТЭН-наночастицы.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 584.  Многофакторный расчет параметров термовзрыва
Программа предназначена для моделирования кинетики взрывного разложения энергетического материала, содержащего поглощающие наноразмерные включения, при облучении его лазерным импульсом. Программа предназначена исследователям и преподавателям, специализирующимся в области химии твердого тела. Основные функции программы: расчет реальных коэффициентов эффективности поглощения включений в зависимости от их радиуса в матрице ТЭНа при облучении образца импульсом неодимового лазера; расчет критической плотности энергии инициирования взрывного разложения ТЭНа, содержащего металлические наноразмерные включения заданного радиуса, с учетом реального коэффициента эффективности поглощения включений; расчет температурного распределения в образце в различные моменты времени с учетом рассчитанной критической плотности энергии.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 585.  Инструментальная библиотека алгоритмов численной оптимизации
Программа предназначена для использования в составе научных программных комплексов анализа данных, например, в схемах структурно-параметрического синтеза математических моделей. Программа располагает тремя алгоритмами: алгоритмом Качмажа, многошаговым и попарным алгоритмами. Данные алгоритмы предназначены для минимизации негладких функционалов большой размерности.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 586.  Программный комплекс для численного расчета течения и распространения примесей в закрытых водоемах Distribution and Stream of Impurity in the Closed Reservoirs
Программа предназначена для получения картин течения и распространения легких и тяжелых примесей в закрытых водоемах с возможностью изменения формы дна и может применяться при решении таких задачах как: распространение примесей в шламоотстойниках; очистка сточных вод аглофабрик с помощью отработанных горных выработок; распространение нефтепродуктов в жидкости в закрытом водоеме и других. Программа обеспечивает выполнение функций: получение картин течения вязкой несжимаемой жидкости в закрытом водоеме; моделирование распространения тяжелых и легких примесей; моделирование изменения области решения; получение результатов в виде текстового файла, пригодного для визуализации в Tecplot.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 587.  Программный комплекс для численного расчета нестационарных течений неоднородной вязкой несжимаемой жидкости Flow of viscous inhomogeneous incompressible fluid
Программа предназначена для расчета и исследования нестационарных течений вязкой несжимаемой двухкомпонентной смеси и может применяться для моделирования различных естественных и технических процессов, где необходим подобный расчет. Ее могут использовать как студенты вузов при выполнении курсовых и дипломных работ, так и более опытные исследователи для моделирования реальных объектов. Программа обеспечивает выполнение следующих функций: построение области решения и расчетной сетки; расчет возникающего течения и уровня концентрации примеси в расчетной области на построенной сетке; экспорт результатов для дальнейшей визуализации.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 588.  Моделирование термического разложения энергетических материалов
Программа предназначена для решения прямой кинетической задачи термолиза азида серебра. Может применяться исследователями и преподавателями, специализирующимися в области химии твердого тела и химической кинетики. Основные функции программы: расчет кинетических зависимостей исходных веществ, промежуточных и конечных продуктов разложения в рамках полного и сокращенного механизма реакции; определение стационарной скорости и концентраций промежуточных продуктов разложения; расчет индукционного периода взрывного разложения; построение графиков кинетических зависимостей и фазовых портретов системы.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 589.  Автоматизированная Рейтинговая Система
Программа предназначена для сбора и хранения данных о достижениях, показателях эффективности и автоматизации расчета рейтинговых показателей эффективности деятельности ППС, научных работников и подразделений университета. Выполняет функции сбора, хранения и предоставления доступа к информации о деятельности ППС и научных работников.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 590.  Программа для портативной интерактивной доски iBox
Программа предназначена для управления интерактивной доской и состоит из двух частей. Первая часть - драйвер, отвечающий за обработку изображения, поступающего с веб-камеры снимающей область пространства, на которую с помощью проектора выводится изображение с компьютера и за процедуру калибровки интерактивной доски. Вторая часть прикладная, обеспечивающая пользовательский функционал интерактивной доски: рисование, создание заметок, вывод мультимедийной и текстовой информации на проектор. Модульность прикладной части позволяет добавлять необходимые на том или ином уроке инструменты и выключать ненужные.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 591.  Модуль индексирования и поиска локальных документов
Программа Модуль индексирования и поиска локальных документов предназначена для эффективного поиска документов на локальном жестком диске или внешнем накопителе информации. Выполняет следующие функции: индексация выбранного пользователем дискового пространства, быстрый поиск по названию документа с помощью индексного файла, фильтр результатов поиска по расширению файла, отображение результатов поиска в окне программы, быстрый доступ к файлу из окна программы.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 592.  Система поддержки процесса моделирования сложных социально-экономических явлений
Программа предназначена для построения многоуровневых иерархических моделей различных социально экономических процессов с оценкой приоритетов их составляющих на основе экспертного опроса. Реализует метод анализа иерархий, позволяет изменять структуру построенной модели (удалять и добавлять новые вершины для любого уровня иерархии) и значения приоритетов ее составляющих, с автоматическим пересчетом всех остальных приоритетов; создавать различные конфигурации групп экспертов и получать их агрегирующие оценки
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 593.  Программный модуль управления расчетами кинетики рекомбинации в полупроводниках
Программа Программный модуль управления расчетами кинетики рекомбинации в полупроводниках предназначена для моделирования кинетики электронно-дырочной рекомбинации в полупроводниках. Выполняет следующие функции: численное интегрирование системы десяти дифференциальных уравнений скорости потоков носителей заряда между зонами и локальными уровнями, при заданных параметрах и начальных условиях. Результатом расчета являются текущие значения концентраций носителей заряда в зонах и на локальных уровнях в заданном временном интервале. Программа реализует широкий набор сервисных функций для обработки и сопоставительного анализа результатов: расчет парциальных интенсивностей рекомбинационной люминесценции, в том числе в условиях линейного роста температуры, сохранение и представление, в том числе в различных комбинациях, всех рассчитанных функций в табличном и графическом виде.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 594.  Система Электронный деканат
Программа Система Электронный деканат предназначена для учета успеваемости студентов высшего профессионального образования. Выполняет следующие функции: занесение в систему данных о специальностях и категориях студентов, преподаваемых дисциплинах, формирование рабочих учебных планов; прием студентов на обучение, индивидуальный контроль успеваемости по каждой дисциплине согласно учебным планам; перевод студентов на следующий год обучения или их отчисление; создание различных аттестационных ведомостей и отчетов на основе выборки данных из системы.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 595.  Система управления электронными курсами
Программа Система управления электронными курсами предназначена для программного и контентного обеспечения электронного дистанционного обучения. Учебные материалы (контент) могут быть представлены во всех наиболее распространенных форматах (тексто-графические, аудио, видео). Функционал программы обеспечен в соответствии с тремя категориями пользователей. Профиль администратора обеспечен общепринятыми широкими полномочиями и функциями. Профиль обучающегося (персонифицированный) имеет разделы: Учебные материалы, Контроль знаний, Объявления, Консультации, позволяет обмениваться сообщениями и материалами с преподавателем. Профиль преподавателя со своей стороны обеспечивает контентом все сервисы обучающегося, а также позволяет протоколировать деятельность обучающегося в процессе прохождения и накопления рейтинга по курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 596.  Статистическая обработка результатов АСТ-тестирования
Программа предназначена для оценки уровня знаний испытуемых и определения качества тестирования согласно Классической теории тестирования и Однопараметрической модели Раша. Обрабатывая дихотомические матрицы, сформированные комплексом АСТ-Тест, программа рассчитывает основные характеристики теста (трудность, легкость заданий, количество представлений), строит гистограмму частотной характеристики выпадения тестовых заданий, определяет среднее значение логитов трудности, выявляет ненадежные вопросы в тесте, оценивает, адекватен ли тест по трудности. Для повышения точности статистической обработки в программе предусмотрено объединение нескольких матриц тестирования в один файл. Полученные оценки позволят улучшить качество тестирования, сбалансировать тест по трудности, исключить излишне легкие и трудные вопросы.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 597.  Программный комплекс для численного расчета нестационарных течений однородной жидкости DES
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 598.  Распределенная автоматизированная система обнаружения логических ошибок в MPI-программах
Программная система служит для поиска семантических ошибок в параллельных приложениях, вызванных некорректным использованием интерфейса MPI. Применяется подход автоматизированного контроля корректности во время исполнения. Система состоит их 3 компонент: консольных препроцессора и сервера отладки и профилировочной библиотеки. Исходный код MPI-программы сначала должен быть обработан препроцессором, а затем слинкован с библиотекой. Запускать следует сначала сервер, а потом – откомпилированное параллельное приложение. В процессе работы библиотека производит сбор информации о вызываемых MPI-функциях и передает параметры функций серверу через TCP-сокеты. Сервер анализирует принятые параметры и производит вывод о возникновении в программе семантических ошибок (дедлоки, гонки данных и пр. ) В некоторых случаях сервер передает управляющие сигналы MPI-процессам, принимаемые и обрабатываемые дополнительными потоками.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 599.  RadioCad
Программный продукт предназначен для обработки цифровых рентгенограмм. Программа предназначена для исследователей, специализирующихся в области рентгеноструктурного анализа, и преподавателей кристаллохимии. Программа обеспечивает выполнение следующих функций: построение графиков; устранение шумов сигнала; определение положения и амплитуды максимумов на рентгеновской зависимости; определение ширины переднего и заднего фронта для каждого пика; вычитание фонового сигнала.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 600.  Демонстрации по атомной физике: Тонкая структура спектральных линий атомов щелочных металлов
Программа Демонстрации по атомной физике: Тонкая структура спектральных линий атомов щелочных металлов предназначена для интерактивных лекционных демонстраций оптических квантовых переходов между компонентами тонкой структуры атомных термов, соответствующих спектральным линиям и их тонкой структуре в атомах щелочных металлов. Выполняет следующие функции: формирование набора атомных термов и их компонентов тонкой структуры, формирование наборов пар компонентов тонкой структуры термов, между которыми осуществляются квантовые переходы, индикацию (показ) ошибочных действий пользователя, поэтапное визуальное отображение формирования тонкой структуры спектральных линий атомов щелочных металлов в виде общепринятых графических образов по данному учебному курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 601.  Демонстрации по атомной физике: Тонкая структура спектральных линий многоэлектронных атомов
Программа Демонстрации по атомной физике: Тонкая структура спектральных линий многоэлектронных атомов предназначена для интерактивных лекционных демонстраций оптических квантовых переходов между компонентами тонкой структуры атомных термов, соответствующих спектральным линиям и их тонкой структуре в многоэлектронных атомах. Программа позволяет задавать наборы атомных термов (для связи Рассела-Саундерса) в широком диапазоне количества электронов во внешней электронной оболочке атома. Выполняет следующие функции: формирование набора атомных термов и их компонентов тонкой структуры, формирование наборов пар компонентов тонкой структуры термов, между которыми осуществляются квантовые переходы, индикацию (показ) ошибочных действий пользователя, поэтапное визуальное отображение формирования тонкой структуры спектральных линий в виде общепринятых графических образов по данному учебному курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 602.  Оптические спектры атомов: интерактивный практикум по курсу Атомная физика
Программа Оптические спектры атомов: интерактивный практикум по курсу Атомная физика предназначена для отработки практических навыков и контроля учебных достижений в интерактивном режиме. Выполняет следующие функции: формирование и предъявление условия задачи, проверку правильности вводимых значений вычисляемых параметров в процессе решения задачи и конечного результата, индикацию (показ) правильных и ошибочных действий пользователя, поэтапное визуальное отображение хода решения задачи и конечного результата в виде общепринятых графических образов по данному учебному курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 603.  Атомные термы: интерактивный практикум по курсу Атомная физика
Программа Атомные термы: интерактивный практикум по курсу Атомная физика предназначена для отработки практических навыков и контроля учебных достижений в интерактивном режиме. Выполняет следующие функции: формирование и предъявление условия задачи, проверку правильности вводимых значений вычисляемых параметров в процессе решения задачи и конечного результата, индикацию (показ) правильных и ошибочных действий пользователя, поэтапное визуальное отображение хода решения задачи и конечного результата в виде общепринятых графических образов по данному учебному курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 604.  Эффект Зеемана: интерактивный практикум по курсу Атомная физика
Программа Эффект Зеемана: интерактивный практикум по курсу Атомная физика предназначена для отработки практических навыков и контроля учебных достижений в интерактивном режиме. Выполняет следующие функции: формирование и предъявление условия задачи, проверку правильности вводимых значений вычисляемых параметров в процессе решения задачи и конечного результата, индикацию (показ) правильных и ошибочных действий пользователя, поэтапное визуальное отображение хода решения задачи и конечного результата в виде общепринятых графических образов по данному учебному курсу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 605.  Интерактивная викторина English Ice-Brakers
База данных представляет собой комплекс дидактических материалов, организованных в виде интерактивной викторины. Материалы базы данных объединены в модули и состоят из тестовых заданий и иллюстрирующих их систематизированных изобразительных и аудиофрагментов. Навигация по базе данных осуществляется с помощью гиперссылок. Содержание базы данных направлено на формирование первичного коллектива студентов, определение уровня владения английским языком, диагностику сформированности лингвокультурологической компетенции. Любой модуль базы данных может быть использован отдельно в курсе преподавания практики английского языка или для проведения конкурсов и квизов. Данный продукт предназначен для студентов и старшеклассников, интересующихся культурой Великобритании.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 606.  База данных для Автоматизированной Рейтинговой Системы
База данных предназначена для хранения информации о сотрудниках, подразделениях университета, результатах деятельности сотрудников, показателях эффективности их деятельности, результатов их деятельности и прочей служебной информации. Для реализации системы защиты информации создано пять таблиц, в которых хранится информация о ролях и правах доступа, логинах и паролях пользователей. Расчет рейтинга производится посредством процедуры, хранящейся в БД. База данных состоит из 28 таблиц и 1 представления: Achievement, action, author, classification, employee, emp_qualgr, emp_rating, emp_scideg, emp_subdiv, factor, factor_class, factor_rating_type, factor_type, faculty, logtable, post, qualification_group, rating_type, role, role_action, scientific_degree, session, subdivision, sub_rating, sup_rating, user, user_role, weight, v_achievement.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 607.  Мультимедийный электронный учебно-методический комплекс Растровая графика на примере свободного ПО
БД мультимедийный электронный учебно-методический комплекс Растровая графика на примере свободного ПО содержит теоретический и практический материал по курсу Компьютерная графика и анимация. Данная БД представлена HTML-документами, организованными в виде следующих блоков: рабочая программа, курс лекций, практикум, методические рекомендации, контрольно-измерительные материалы. Навигация по блокам базы данных осуществляется с помощью меню и гиперссылок. База данных предназначена для слушателей курсов повышения квалификации научно-педагогических работников вузов в области информационных технологий.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 608.  Мультимедийный электронный учебно-методический комплекс Информационные ресурсы в менеджменте
БД представлена HTML-документами, организованными в виде совокупности 5 блоков: рабочая программа, курс лекций, практикум, методические рекомендации, контрольно-измерительные материалы. Система навигации по блокам базы данных осуществляется с помощью меню и гиперссылок. БД содержит теоретический и практический материал по дисциплине Информационные ресурсы в менеджменте и предназначена для студентов вузов экономических специальностей всех форм обучения.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 609.  Учебная программа для дисциплины Налогообложение для средних школ
База данных предназначена для общеобразовательных средних школ субъектов Российской Федерации. Состоит из 2 блоков: 1. Анализ специальной литературы по вопросам российского налогообложения, существующих учебно-методических материалов для высшей школы, используемый для разработки образовательных материалов для школьников 8-9 классов; 2. Разработка макета учебных материалов с разбивкой по урокам. Система навигации осуществляется при помощи гиперссылок.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 610.  Мониторинг индивидуальных программ развития (МИПР)
Программный комплекс Мониторинг индивидуальных программ развития позволяет отследить динамику индивидуального развития ребенка, оценить эффективность индивидуальных программ развития (ИПР). Использование программного комплекса повышает информативность процесса разработки и коррекции ИПР специалистами органа управления процессом развития в социально-реабилитационных центрах. Результаты предыдущих курсов развития могут служить дополнительным информационным обеспечением при разработке индивидуальной программы развития для вновь поступившего ребенка.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 611.  Программный комплекс для численного расчета течений, вызванных перепадом давления Flow Produced by Given Pressure Drop
Программа предназначена для расчета и исследования течений, причиной которых является перепад давления, и может применяться в проектировании гидротехнических сооружений и других областях, где необходим подобный расчет. Программа обеспечивает выполнение следующих функций: построение области решения; генерация расчетной сетки. ; расчет возникающего течения в расчетной области на построенной сетке; экспорт результатов для дальнейшей визуализации.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 612.  Программный комплекс для численного решения дифракции волн в закрытых акваториях Wave Diffraction in Closed Bays
Программа предназначена для проведения исследования и определения характера волнения в закрытых акваториях и может применяться в проектировании гидротехнических сооружении и других областях, где необходимо рассчитать дифракцию волн в закрытых бухтах. Программа обеспечивает выполнение следующих функций: построение области решения; генерация расчетной сетки; расчет взаимодействия волнения в расчетной области на построенной сетке; определение характера дифракции волн на основе данных о высоте волны; экспорт результатов в текстовом формате для дальнейшей визуализации.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 613.  Программный комплекс для инженерного проектирования гидротехнических сооружений DirtFlow
Программа предназначена для проведения исследования течения и определения характера распространения загрязнения в проточном водоеме и может применятся в проектировании гидротехнических сооружения и других областях, где необходимо рассчитать течение и распространение примеси в водоеме. Программа обеспечивает выполнение следующих функций: построение области решения; генерация расчетной сетки; расчет течение в расчетной области на построенной сетке; определение характера распростране¬ ния примесей на основе данных о течении; экспорт результатов в текстовом формате для дальнейшей визуализации.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 614.  Автоматизированный способ создания и управления планами факультетов юридических специальностей (UrGraph)
Программа UrGraph создана на основе методов виртуального программирования, предназначена для эффективного управления учебными планами на факультетах юридических специальностей. Может применяться в учебном процессе правовых факультетов, в вузовской и послевузовской системе образования и т. д. Программа UrGraph обеспечивает выполнение следующих функций: создание и управление планами проведения учебных занятий по семестрам на факультетах юридических и других специальностей; формирование и управление кафедральной учебной нагрузкой в соответствии с текущим учебным годом; добавлять и изменять данные в текущей базе учебных планов через специально созданную форму; позволяет контролировать и рассчитывать все виды учебных нагрузок по кафедрам факультетов соответствующих специальностей.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 615.  Мультимедийное приложение Оптика для Office 2003
База данных Мультимедийное приложение Оптика представлено HTML-документом, содержащим три раздела: сборник анимированных и озвученных слайд-лекций; сборник текстовых документов по основным темам оптики; сборник флеш-роликов. Навигация по базе данных осуществляется с помощью меню и гиперссылок. Электронное мультимедийное приложение адресовано преподавателям и студентам ВУЗов естественно-научных факультетов, учителям и школьникам.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 616.  Патентные исследования по созданию регионального стандарта Кемеровской области
База данных предназначена для использования при разработке и постановке продукции на производство, учитывает наполненность патентных фондов Кемеровской области и содержит перечень источников информации на электронных носителях. Проект включает разработанную систему проведения патентных исследований по видам информационных источников с различной ретроспективностью поиска в зависимости от задач исследования на различных стадиях жизненного цикла продукции, дополнен приложением о порядке проведения маркетинговых исследований разработок, ориентированных на коммерциализацию. Система навигации осуществляется и при помощи гиперссылок.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 617.  Устройство плавного пуска для группы ассинхронных электродвигателей
Описание устройства плавного пуска для группы ассинхронных электродвигателей
 618.  Способ предотвращения пожара в торфяниках
Описание способа предотвращения пожара в торфяниках
 619.  Способ аэрации жидкости
Описание способа аэрации жидкости
 620.  Валковая дробилка
Описание валковой дробилки
 621.  Модель функционирования предприятия
Программа для моделирования процесса функционирования предприятия
 622.  Технология производства нагревательных элементов для приборов, предназначенных для нагрева сложной воздушной среды (естественная конвенция)
Описание технологии производства нагревательных элементов для приборов, предназначенных для нагрева сложной воздушной среды (естественная конвенция)
 623.  Устройство для подъема груза с большой глубины
Действующая модель устройства для подъема груза с большой глубины
 624.  Способ подогрева и перемешивания вязких сред и устройство для его осуществления
Технология подогрева и перемешивания вязких сред и устройство для его осуществления
 625.  Устройство для диагностики скважинной системы контроля
Устройство для диагностики скважинной системы контроля
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 626.  Способ обогащения масла системы смазки двигателя внутреннего сгорания легирующими элементами цветных металлов и устройство для его осуществления (варианты)
Способ обогащения масла системы смазки двигателя внутреннего сгорания легирующими элементами цветных металлов и устройство для его осуществления (варианты)
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 627.  Стеновое ограждение здания
Стеновое ограждение здания
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 628.  Способ контроля многофазного потока в трубопроводе
Способ контроля многофазного потока в трубопроводе
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 629.  Способ защиты трубопроводов от коррозии
Способ защиты трубопроводов от коррозии
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 630.  Способ контроля и управления забойными параметрами режима бурения
Способ контроля и управления забойными параметрами режима бурения
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 631.  Дисперсно- армированный тампонажный раствор
Дисперсно- армированный тампонажный раствор
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 632.  Способ получения электроэнергии
Способ получения электроэнергии
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 633.  Способ разработки газонефтяных залежей
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 634.  Способ разработки газогидратных залежей
Способ разработки газогидратных залежей
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 635.  Способ подземной газификации и дегазации углей (варианты)
Способ подземной газификации и дегазации углей (варианты)
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 636.  Способ строительства и эксплуатации многозабойной скважины
Способ строительства и эксплуатации многозабойной скважины
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 637.  Устройство для корчевания деревьев (варианты)
Устройство для корчевания деревьев (варианты)
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 638.  Устройство для передачи информации из скважины на поверхость
Устройство для передачи информации из скважины на поверхость
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 639.  Устройство для передачи информации из скважин на поверхность
Устройство для передачи информации из скважин на поверхность
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 640.  Способ выявления участков трубопроводов подверженных коррозионному растрескиванию под напряжением
Способ выявления участков трубопроводов подверженных коррозионному растрескиванию под напряжением
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 641.  Способ предотвращения развития дефектов стенок трубопроводов
Способ предотвращения развития дефектов стенок трубопроводов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 642.  Способ ремонта провисающих и размытых участков подземного трубопровода
Способ ремонта провисающих и размытых участков подземного трубопровода
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 643.  Способ определения наличия и площади эквивалентного повреждения в изоляционном покрытии подземного трубопровода
Способ определения наличия и площади эквивалентного повреждения в изоляционном покрытии подземного трубопровода
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 644.  Способ обработки полуфабрикатов из сплавов с термоупругими мартненситными превращениями
Способ обработки полуфабрикатов из сплавов с термоупругими мартненситными превращениями
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 645.  Термошахтный способ разработки трещиноватой залежи высоковязкой нефти
Термошахтный способ разработки трещиноватой залежи высоковязкой нефти
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 646.  Установка для испытания образцов материалов на растяжение, сжатие и кручение при постоянной и переменной нагрузках
Установка для испытания образцов материалов на растяжение, сжатие и кручение при постоянной и переменной нагрузках
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 647.  Инерционный фильтрующий сепаратор
Инерционный фильтрующий сепаратор
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 648.  Диффузионная ячейка
Диффузионная ячейка
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 649.  Нагружающий механизм установки для испытания образцов материала на ползучесть и длительную прочность- одних на растяжение, а других на изгиб и кручение
Нагружающий механизм установки для испытания образцов материала на ползучесть и длительную прочность- одних на растяжение, а других на изгиб и кручение
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 650.  Контейнерное тиристорное устройство
Контейнерное тиристорное устройство
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 651.  Устройство для контроля состояния насосных агрегатов магистрального нефтепровода
Устройство для контроля состояния насосных агрегатов магистрального нефтепровода
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 652.  Устройство для измерения вязкости нефти в трубопроводе
Устройство для измерения вязкости нефти в трубопроводе
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 653.  Способ комплексной утилизации нефтесодержащих отходов случайного состава и установка для его осуществления
Способ комплексной утилизации нефтесодержащих отходов случайного состава и установка для его осуществления
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 654.  Способ гидродинамической томографии проницаемости пласта
Способ гидродинамической томографии проницаемости пласта
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 655.  Беспроводной пульсометр
Беспроводной пульсометр
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 656.  Поршневое маслосъемное кольцо
Поршневое маслосъемное кольцо
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 657.  Способ выявления отслаивания открытия подземных трубопроводов
Способ выявления отслаивания открытия подземных трубопроводов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 658.  Установка для испытания трубчатых образцов на усталость при сложном напряженном состоянии
Установка для испытания трубчатых образцов на усталость при сложном напряженном состоянии
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 659.  Установка для исследования фильтрационных процессов в прибойной зоне пласта горизонтальной скважины
Установка для исследования фильтрационных процессов в прибойной зоне пласта горизонтальной скважины
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 660.  Способ обработки полуфабрикатов сплава никелида титана ТН-1
Способ обработки полуфабрикатов сплава никелида титана ТН-1
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 661.  Устройство для разделения контуров анодных заземлений катодной защиты и контуров защитного заземления и молниезащиты
Устройство для разделения контуров анодных заземлений катодной защиты и контуров защитного заземления и молниезащиты
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 662.  Способ крепления теплоизоляции скважины
Способ крепления теплоизоляции скважины
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 663.  Программа расчета степени опасности различных участков лесовозных автомобильных дорог
Программа расчета степени опасности различных участков лесовозных автомобильных дорог
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 664.  Определитель тестовых классов
Определитель тестовых классов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 665.  Система материального стимулирования профессорско-преподавательского состава ВУЗа
Система материального стимулирования профессорско-преподавательского состава ВУЗа
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 666.  Компьютерные лаботорные работы
Компьютерные лаботорные работы
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 667.  Обобщенный определитель тестовых классов
Обобщенный определитель тестовых классов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 668.  Программа для фильтрации данных сейсморазведки с целью получения трансформант волнового поля, в которых усилены амплитуды относящиеся к полезному сигналу
Программа для фильтрации данных сейсморазведки с целью получения трансформант волнового поля, в которых усилены амплитуды относящиеся к полезному сигналу
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 669.  Программа для решения прямой и обратной задач магнито-теллурического зондирования. В трехмерных сложнопостроенных средах, характиризующихся расределенными параметрами
Программа для решения прямой и обратной задач магнито-теллурического зондирования. В трехмерных сложнопостроенных средах, характиризующихся расределенными параметрами
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 670.  Программа формирования транспортных связей между блоками предприятий
Программа формирования транспортных связей между блоками предприятий
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 671.  Программа формирования транспортных потоков лесных грузов внутри предприятия и между предприятиями одного блока
Программа формирования транспортных потоков лесных грузов внутри предприятия и между предприятиями одного блока
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 672.  Программа расчета себестоимости ремонтных работ и промышленных изделий предприятий технического сервиса
Программа расчета себестоимости ремонтных работ и промышленных изделий предприятий технического сервиса
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 673.  Программа расчета надежности автомобилей различных марок
Программа расчета надежности автомобилей различных марок
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 674.  Компонент интеграции с ФИС ЕГЭ и приема
Компонент интеграции с ФИС ЕГЭ и приема
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 675.  Комплекс инструментов для автоматизированного контроля качества данных географических исследований скважин
Комплекс инструментов для автоматизированного контроля качества данных географических исследований скважин
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 676.  Система индексно-рейтинговой оценки и материального стимулирования студентов вуза
Система индексно-рейтинговой оценки и материального стимулирования студентов вуза
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 677.  Программа для учета интеллектуальной собственности и управления патентным фондом предприятия
Программа для учета интеллектуальной собственности и управления патентным фондом предприятия
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 678.  Индексная система оценки результатов деятельности и стимулирования трудового коллектива
Индексная система оценки результатов деятельности и стимулирования трудового коллектива
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 679.  Программа для учета интеллектуальной собственности и управления патентным фондом предприятия.
Программа для учета интеллектуальной собственности и управления патентным фондом предприятия.
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 680.  Индексная система оценки результатов деятельности и стимулирования трудового коллектива
Индексная система оценки результатов деятельности и стимулирования трудового коллектива
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 681.  Автоматизированная система учета договоров
Автоматизированная система учета договоров
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 682.  Автоматизированная информационная система табельного учета рабочего времени ФГБОУ ВПО
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 683.  Система материального стимулирования сотрудников СМСС
Система материального стимулирования сотрудников СМСС
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 684.  Программа технико-экономического обоснования вариантов дорожной одежды лесовозных автомобильных дорог
Программа технико-экономического обоснования вариантов дорожной одежды лесовозных автомобильных дорог
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 685.  Программа расчета средней скорости глубинного показателя коррозии
Программа расчета средней скорости глубинного показателя коррозии
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 686.  Программный редактор геолого-геофизических моделей среды
Программный редактор геолого-геофизических моделей среды
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 687.  Автоматизированная информационная система управления приемной кампанией ГОУ ВПО УГТУ
Автоматизированная информационная система управления приемной кампанией ГОУ ВПО УГТУ
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 688.  Автоматизированная информационная система управления данными деканатов ГОУ ВПО УГТУ
Автоматизированная информационная система управления данными деканатов ГОУ ВПО УГТУ
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 689.  Автоматизированная информационная система формирования и управления расписанием учебных занятий ГОУ ВПО УГТУ
Автоматизированная информационная система формирования и управления расписанием учебных занятий ГОУ ВПО УГТУ
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 690.  Автоматизированная информационная системы учета учебной нагрузки профессорско - преподавательского состава ГОУ ВПО УГТУ
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 691.  Программный модуль для формирования расчетных режимов работы магистральных нефтепроводов
Программный модуль для формирования расчетных режимов работы магистральных нефтепроводов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 692.  Программный модуль для расчета параметров освобождения от нефти участков магистральных нефтепроводов при ремонтах
Программный модуль для расчета параметров освобождения от нефти участков магистральных нефтепроводов при ремонтах
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 693.  Программный модуль для расчета допустимых режимов работы магистральных нефтепроводов при устранении дефектов
Программный модуль для расчета допустимых режимов работы магистральных нефтепроводов при устранении дефектов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 694.  Программа предназначена для определения фронта фазового перехода в твердом пористом
Программа предназначена для определения фронта фазового перехода в твердом пористом
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 695.  Программа повышения транспортно-эксплуатационного уровня автомобильных дорог Республики Коми
Программа повышения транспортно-эксплуатационного уровня автомобильных дорог Республики Коми
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 696.  Программный модуль инверсии геолого-геофизических моделей среды на основе эволюционно-динамических принципов
Программный модуль инверсии геолого-геофизических моделей среды на основе эволюционно-динамических принципов
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 697.  Комплекс инструментов для динамического построения геоголого - геофизических моделей профилей
Комплекс инструментов для динамического построения геоголого - геофизических моделей профилей
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 698.  Программа расчета нечетких петрофизических композиций FuzzyCorrelation
Программа расчета нечетких петрофизических композиций
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 699.  Устройство для корчевания деревьев (варианты)
Полезная модель Устройство для корчевания деревьев (варианты) предназначена для рынка сельского и лесного хозяйства, комплексного использования древесины, биоэнергетики. Также относится к лесной промышленности и может быть использована при заготовке биомассы целыми деревьями. Техническим результатом полезной модели является эффективное корчевание дерева для последующей его комплексной перевозки
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 700.  Механизм поворота сочлененной транспортной машины
Полезная модель Механизм поворота сочлененной транспортной машины предназначена для рынка машин для лесной, строительной и нефтегазовой отрасли. Задачей полезной модели является снижение энергозатрат необходимых для поворота транспортной системы во время маневрирования, а так же создание возможности транспортному средству эффективно преодолеть рельефные препятствия под любым углом.
ФГБОУ ВПО Ухтинский государственный технический университет 169300, Республика Коми, г. Ухта, ул. Первомайская, д. 13
 701.  Тренажер-имитатор по профессиональному букетированию
Тренажер-имитатор позволяет приобрести и отработать основные умения и навыки по профессиональному букетированию без использования традиционного флористического материала. Данный тренажер-имитатор сокращает расходы на учебный материал, поскольку может использоваться неоднократно, а так же не требуется приобретение традиционного флористического материала. Возможность неоднократного использования позволяет многократно отрабатывать любую технику букетирования до полного её освоения, в то время как работа с традиционным флористическим материалом затрудняется из-за низкой жизнестойкости материала.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 702.  Способ определения индивидуальной чувствительности генома человека к воздействию радона
Изобретение относится к области медицины, а именно к генетике человека. Для оценки индивидуальной чувствительности генома к воздействию радона проводят генетическое исследование крови и определяют предрасполагающие и протективные генотипы: маркер Arg280His гена XRCC1 - предрасполагающий генотип Arg/ Arg, протективный генотип Arg/ His; маркер Argl94Trp гена XRCC1 -предрасполагающий генотип Arg/ Arg, протективный генотип Arg/ Trp; маркер Asn148Glu гена АРЕ1 - предрасполагающий генотип Glu/ Glu, протективные генотипы Asn/ Asn, Asn/ Glu; маркер A2455G гена CYP1A1 - предрасполагающий генотип A/ G, протективные генотипы А/ А и G/ G; маркер делеция в гене GSTM1 - предрасполагающий генотип о/ о, протективный . Делают заключение о высокой индивидуальной чувствительности к действию повышенных доз радона при количественном преобладании предрасполагающих генотипов или равном количестве предрасполагающих и протективных генотипов. Высокую индивидуальную устойчивость к воздействию повышенных доз радона определяют при количественном преобладании протективных генотипов. Использование способа позволяет провести оценку генетически детерминированной предрасположенности к формированию повышенного уровня хромосомных аберраций еще до воздействия радиационного фактора.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 703.  Способ автоматизированного текущего прогноза внезапных выбросов угля и газа
Изобретение относится к горной промышленности и может быть использовано для определения выбросоопасности угольных массивов. Техническим результатом изобретения является повышение точности и оперативности определения выбросоопасности угольных массивов при выполнении текущего прогноза внезапных выбросов угля и газа. Для этого определяют отношение К амплитуд высокочастотной и низкочастотной частей спектра акустических колебаний, генерируемых режущим инструментом в угольный массив, в процессе проведения выработки. Сравнивают текущие значения показателя Кт с предельно допустимым значением Кт_пред. При этом предельно допустимое значение Кт_пред непрерывно автоматически корректируют в соответствии с текущим значением концентрации метана в атмосфере выработки, регистрируемой аппаратурой контроля метана, и периодически корректируют в соответствии с измеряемой прочностью угля прочностномером П-1. Зону угольного пласта относят к выбросоопасной, если Kт > Кт_пред или Kт = Кт_пред, и к невыбросоопасной, если Кт < Кт_пред
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 704.  Способ определения профессиональной пригодности лиц для работы в условиях повышенного содержания угольной пыли
Изобретение относится к медицине, в частности к цитогенетике человека. Определение профессиональной пригодности лиц выполняют путем исследования клеток крови. Получают препарат хромосом, окрашивают его путем нанесения азотнокислого серебра и определяют цитогенетические показатели: суммарную активность AgЯОР, количество Ag-положительных ЯОР, аргентофильность D-хромосом, аргентофильность G-хромосом, ассоциативный индекс, число ассоциаций на клетку с ассоциациями, число ассоциирующих акроцентриков на клетку с ассоциациями. На основании полученных данных при учете индивидуального возраста рассчитывают уровень вероятности высокого уровня хромосомных аберраций и при его значении 50% и менее определяют профессиональную пригодность испытуемого для работы в условиях повышенного содержания угольной пыли. Использование способа позволяет повысить точность определения профессиональной пригодности испытуемого для работы в условиях повышенного содержания угольной пыли.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 705.  Способ изготовления фотографической эмульсии на основе галогенидосеребряных пластинчатых микрокристаллов с эпитаксиальными наноструктурами
Изобретение относится к фотографической промышленности, в частности к технологии приготовления галогенидосеребряных фотографических эмульсий. Согласно изобретению изготовление фотографических эмульсий на основе галогенидосеребряных пластинчатых микрокристаллов (ПМК) с эпитаксиальными наноструктурами проводят сначала приготовлением ядровой эмульсии из растворов AgNO_3 и KBr. Затем получают субстратные ПМК AgBr введением в ядровую эмульсию растворов AgNO_3 и KBr. На полученных ПМК AgBr образуют угловые эпитаксиальные наноструктуры состава AgBr/ AgCl введением в реакционную смесь растворов KI и KCl. На завершающем этапе дополнительно проводят сначала первичное конвертирование эпитаксиальных наноструктур введением в реакционную смесь раствора KBr, затем вторичное конвертирование добавлением отдельно приготовляемой малоразмерной эмульсии состава AgBr_0, 98 I_0, 02 - AgBr_0, 90 I_ 0, 10. Предложенный способ позволяет упростить технологию получения фотографических эмульсий с оптимальными фотографическими характеристиками светочувствительности, вуалестойкости, а также с дисперсионными характеристиками микрокристаллов, пригодными для использования в промышленно изготавливаемых фотоматериалах.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 706.  Способ изготовления галогеносеребряной фотографической эмульсии
Изобретение относится к технологии приготовления фотографических эмульсий для кинофотоматериалов. В таких технологиях часто используют прием допирования микрокристаллов ионами тяжелых металлов для улучшения сенситометрических характеристик эмульсионных слоев. Предлагаемый способ изготовления фотоэмульсий с использованием допирования заключается в проведении двухструйной кристаллизации растворов азотнокислого серебра и бромида калия, прерывании процесса одномоментного введения раствора соединения иридия в качестве допанта и завершении процесса двухструйной кристаллизации. При этом прерывание процесса производят на период за 30-120 с до одномоментного введения и выдержки 30-120 с после введения раствора соединения иридия. В качестве соединений иридия используют комплексные соединения из группы К2[IrВr6], К2[IrСl6], K2[IrBr5Cl], K 2[IrCl5Br] в концентрации от 10-7 до 10-9 моль/ моль Ag. Технический результат: улучшение сенситометрических характеристик за счет увеличения продолжительности электронной стадии образования центров скрытого изображения и более эффективного использования образующихся в процессе экспонирования фотоэлектронов.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 707.  Способ изготовления тонированных мягких контактных линз
Настоящее изобретение относится к технологии получения мягких контактных линз. Описан способ изготовления тонированных мягких контактных линз путем получения полимерного материала для линз, включающий растворение красителя в гидрофильном мономере, в качестве которого берут N-винилпирролидон, сополимеризацию полученного раствора с гидрофобным мономером - метилметакрилатом - в присутствии дивинилового сшивающего агента, последующую обработку полученной полимерной смеси и получения контактных линз, отличающийся тем, что в качестве красителя используют кислотный антрахиноновый краситель и сополимеризацию мономеров проводят под действием ионизирующего излучения. Технический результат - упрощение технологии на всех этапах получения окрашенного гидрогелевого материала для мягких контактных линз с улучшенными физико-химическими характеристиками.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 708.  Рабочее вещество для термолюминесцентного детектора ионизирующего излучения
Изобретение относится к получению рабочего вещества, которое может быть использовано для изготовления термолюминесцентного детектора ионизирующего излучения, использующегося в индивидуальной дозиметрии для определения поглощенных доз персонала; для определения поглощенных доз пациентов при проведении рентгеновской диагностики и терапии; при определении поглощенных доз в поле облучения высокодозовых технологических установок. Технический результат - расширение диапазона регистрируемых доз ионизирующего излучения рабочего вещества по пику, обусловленному поглощением SiO2, с максимумом при 154° С, от 10^-4 кГр до 1 кГр и по пику, обусловленному поглощением УДА, с максимумом при 270° С, от 1 кГр до 100 кГр. Рабочее вещество для термолюминесцентных детекторов ионизирующего излучения включает нанодисперсный порошок алмаза с размером частиц около 5 нм, порошок материала на основе SiO2, размельченный до крупности < 0, 08 мм, и силикатный клей в качестве связующего двух материалов. Синтез композитного рабочего вещества проводят путем смешивания SiO2 и УДА в пропорциях, мас. %: ультрадисперсный порошок алмаза с размером частиц около 5 нм - 25-65, SiO2 - 25-65, силикатный клей - остальное.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 709.  Имитационно-обучающая программа для студентов-юристов и совершенствования профессиональных навыков оперативно-следственных работников (Гермес)
Программа Гермес создана на основе методов виртуального моделирования, предназначена для студентов юридических специальностей, а также для оперативно-следственных работников. Может применяться в учебном процессе правовых факультетов, в вузовской и послевузовской системе, а также в профессиональной деятельности адвокатов, следователей, оперработников, прокуроров и т. д. Программа Гермес обеспечивает выполнение следующих функций: осуществлять контроль за уровнем подготовки слушателей, студентов, практических работников; диагностировать уровень профессиональной подготовки по криминалистике различных категорий сотрудников правоохранительных органов; выбирать алгоритмы следственных действий по раскрытию и расследованию преступлений; имитировать тактико-процессуальные действия следователя и следственной группы на основе действующего уголовно-процессуального кодекса РФ.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 710.  Электронный музейный комплекс (Каталог коллекций)
Программа Электронный музейный комплекс предназначена для хранения в структурированном виде сведений о музейных коллекциях и предметах раздельно по каждому реквизиту. Она позволяет вести детальный учет и получать выходные документы необходимые для учета (инвентарные книги, научные паспорта, инвентарные карточки и т. д. ). Программа настроена на три основных блока информации, необходимые для музейной и научной деятельности: учетно-хранительские, каталожные и индивидуальные. Разработанная программа - набор реквизитов для описания коллекции и предмета - не прошита жестко в интерфейс пользователя. Это является главной особенностью предлагаемой программы, на которой основаны все ее положительные качества и преимущества над другими продуктами, предназначенными для решения подобных задач. Доступ к интерфейсу пользователя находится под управлением системы защиты. Набор реквизитов может быть изменен в процессе эксплуатации. Пользователь может сам добавить новые реквизиты и изменить параметры реквизитов.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 711.  Система удаленного управления распределенными вычислительными ресурсами
Программа предназначена для численного решения задач механики идеальной или вязкой жидкости со свободными границами. Библиотека программ предназначена для использования на кластерных системах с интерфейсом передачи сообщений. Разработанная библиотека программ представляет собой набор подпрограмм, реализующих следующие численные методы решения задач гидродинамики со свободными границами: метод граничных элементов (МГЭ); комплексный метод граничных элементов (КМГЭ); метод сглаженных частиц (SPH, ISPH); бессеточный метод конечных элементов (MFEM); метод естественных соседей (NEM); метод Лагранжево-Эйлеровых частиц.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 712.  Библиотека параллельных вычислительных программ для задач гидродинамики со свободными границами (HydroParaLib)
Программа разработана с целью объединения территориально распределенных высокопроизводительных вычислительных систем (компьютерных кластеров) в единую систему, обеспечивающую удобство администрирования и использования этих ресурсов. Ядром программы является сервер, который выбирает из реляционной базы данных программы пользователей, запускает эти программы на удаленных высокопроизводительных вычислительных ресурсах и сохраняет результаты работы программ в виде файлов в базе. Для взаимодействия с сервером и обработки его команд на каждом удаленном вычислительном ресурсе устанавливается программный агент, который отслеживает и сообщает серверу состояние ресурса и запущенных на нем программ. Программа обеспечивает: хранение файлов с расчетными программами, начальными данными и результатами; поддержку очереди заданий на основе приоритетов пользователей; отслеживание состояния доступных вычислительных ресурсов; передачу программ пользователей на вычислительные системы, прием и сохранение файлов с результатами.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 713.  SubFinder
Программа предназначена для выделения и визуализации подрешеток разного типа Бравэ в кристаллических структурах. В программе заложена возможность построения и визуализации многогранников Дирихле-Вороного и зон Бриллюэна для подрешеток и всего кристалла в целом. Ключевыми особенностями программы являются: импорт кристаллографических данных из файлов экспорта базы данных ICSD; выделение подрешеток в кристаллах произвольной пространственной симметрии и определение их типа Бравэ; построение зон Бриллюэна и многогранников Дирихле-Вороного; интерактивная визуализация подрешеток и многогранников при помощи OpenGL; определение сорта зон Бриллюэна; сохранение рассчитанных данных в формате XML; экспорт изображений многогранников в формат IPE.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 714.  Особо охраняемые природные территории Кемеровской области (ООПТ)
Программа Особо охраняемые природные территории Кемеровской области предназначена для хранения в структурированном виде сведений об особо охраняемых природных территориях и биологических ресурсах раздельно по каждому реквизиту. Она позволяет вести детальный учет и получать необходимые выходные документы - отчеты в пределах конкретного объекта и многофакторные, фильтрованные данные по отдельным параметрам. Программа может быть применена для разных регионов и в масштабах страны. Разработанный программный продукт не прошит жестко в интерфейс пользователя, доступ к интерфейсу пользователя находится под управлением системы защиты. Набор реквизитов может быть изменен в процессе эксплуатации. Пользователь может сам добавить новые реквизиты и изменить их параметры.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 715.  Оценка показателей вариационной пульсометрии в состоянии покоя и определение реакции организма человека на различные виды физических нагрузок по показателям сердечного ритма
Программа предназначена для регистрации сердечного ритма в покое и при выполнении различных функциональных проб. Проба Мартине используется для оценки работоспособности сердца при физической нагрузке (задается количество и темп приседаний). Проба Штанге используется для оценки устойчивости организма человека к гипоксии, отражающей общее состояние кислородообеспечивающих систем. Кроме этого предусмотрена проба, длительность и условия выполнения которой задаются пользователем. Для сравнения фиксируются показатели вариационной пульсометрии в состоянии условного покоя по Р. М. Баевскому В итоге формируются заключения о типе регуляции сердечно-сосудистой системы и характере реакции на нагрузочную пробу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 716.  Определение показателей вариационной пульсометрии при выполнении умственной нагрузки
Программа предназначена для регистрации сердечного ритма в при выполнении дозированной нейродинамической нагрузки. Перед началом работы задается объем и темп предъявления цветовых сенсомоторных раздражителей. В ходе последующей математической обработки рассчитываются основные показатели вариационной пульсометрии: мода, амплитуда моды, размах, индекс напряжения, показатель адекватности процессов регуляции, вегетативный показатель ритма, индекс вегетативного равновесия. Также для нейродинамической пробы рассчитываются показатели сенсомоторной деятельности (минимальная экспозиция и время выхода на нее, средняя экспозиция, количество ошибочных реакций и количество пропущенных положительных сигналов). В итоге формируется заключение о типе вегетативной регуляции и о характере реакции на нагрузочную пробу.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 717.  Единая автоматизированная база данных правовой информации (ЮрКлиника)
База данных ЮрКлиника, созданная на основе php-технологий, базе данных MySQL и java-скриптов, предназначена для юридического клинического образования, систематизации и обработки оказанных консультаций населению в целях реализации конституционного принципа доступности правовой помощи. Может применяться в правозащитных организациях, общественных приемных государственных, муниципальных органов власти, политических партий. База данных ЮрКлиника обеспечивает выполнение следующих задач: развить необходимые навыки по применению теоретических знаний на практике студентов; дистанционный контроль практики студентов; сформировать уникальную базу данных клиентов с правовыми запросами; развитие юридического клинического образования; оказание юридической помощи незащищенным слоям населения; создание учебно-методических материалов.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 718.  Информационно-вычислительный портал КемГУ (ИВП КемГУ)
База данных портала является единым хранилищем данных для организации учебной и научной деятельности ВУЗа в сфере решения различных задач с использованием вычислительного эксперимента, проведения научных конференций, хранения и работы с информационными ресурсами. База данных портала содержит следующие блоки: блок кода программ, очереди задач, исходных данных и результатов расчетов численного эксперимента на высокопроизводительном кластере; блок кода электронной библиотеки информационных ресурсов; блок кода научных конференций, их участниках и докладах; блок кода ядра единой системы безопасности портала. Запускается база данных с помощью web-интерфейса. Связь между блоками кода базы данных осуществляется посредством гиперссылок.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 719.  Особо охраняемые природные территории Кемеровской области (ООПТ)
База данных содержит материалы о региональных особенностях деятельности ООПТ, отражает всю совокупность охраняемых объектов, включает иллюстративный материал, имеет возможность корректировки и дополнения данных. Стартовый интерфейс открывает доступ к справочникам: ООГГГ; Ресурсов; Регионов. В БД заполнены поля для Кемеровской области, возможно внесение информации для любого региона Для каждой ООПТ данные структурированы на разделы, подразделы, параметры в соответствии с государственными кадастрами природных ресурсов. Параметры снабжены гиперссылками, дополнительным текстам, изображениями. Справочник ресурсов обеспечивает доступ к информации о биологическом разнообразии объектов. БД позволяет формировать отчеты в пределах конкретного объекта (ООПГ, ресурса, параметра) и многофакторные, получать фильтрованные данные по отдельным параметрам. Ресурсы БД могут обеспечивать информацией о существующих ООПТ и результатах их мониторинга органы государственной власти, общественные организации, использоваться в учебном процессе в качестве учебно-методических материалов.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 720.  Фауна Кемеровской области (ЗооКем)
База данных содержит информацию о видах позвоночных животных и обеспечивает проведение научно-исследовательских работ в области систематики, таксономии, морфологии животных, применяется в работах по изучению фауны на территории Кемеровской области и прикладных разработках по природоохранной тематике. Содержит подробные сведения о таксономическом и природоохранном статусе, экологии, местам сборов и хозяйственном значении по 483 видам позвоночных животных, обитающих на территории Кемеровской области. Включает меню главной формы, просмотр данных (отображаются поля ООПТ, ботанико-географические и административные районы, местонахождения, иллюстративные материалы, экологические и хозяйственные группы животных и т. д. ), редактирование (изменение и дополнение информации о видах животных). Поисковая система позволяет организовать отчеты и получать информацию в зависимости от заданных условий. Навигация осуществляется системой перекрестных и последовательных ссылок, позволяющих взаимодействовать как с основным меню, так и с отдельными блоками.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 721.  Флора Кемеровской области (ФлоКем)
База данных обеспечивает проведение научно-исследовательских работ в области систематики, таксономии, морфологии растений, применяется в работах по изучению флоры на территории Кемеровской области и прикладных природоохранных разработках. Содержит подробные сведения о таксономическом, природоохранном статусе, экологии, местах сборов и хозяйственного значения по 1556 видам растений произрастающих на территории Кемеровской области. Включает меню главной формы, просмотр данных (отображаются поля ООТП, ботанико-географические и административные районы, местонахождения, иллюстративные материалы, экологические и хозяйственные группы растений и т. д. ), редактирование (изменение и дополнение информации о видах растений). Поисковая система позволяет организовать информацию в зависимости от заданных условий. Навигация осуществляется системой перекрестных и последовательных ссылок, позволяющих взаимодействовать как с основным меню, так и между отдельными блоками.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 722.  Электронное учебное пособие Основы теории химической связи
База данных электронного учебного пособия Основы теории химической связи представлена HTML-документами, организованными в виде следующих блоков: содержание, главы, предметный указатель, список литературы. Навигация по блокам базы данных осуществляется с помощью меню и гиперссылок. Электронное учебное пособие разработано по специальности 010701 Физика для специализации Химическая физика и предназначено для самостоятельной работы студентов. Пособие знакомит читателя с теорией химической связи и результатами ее применения к описанию строения и свойств соединений различных классов. Рекомендуется также студентам химического и биологического факультетов, изучающим курс общей химии.
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 723.  Электронный учебно-методический комплекс Русский язык и культура речи (Культура речи)
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 724.  Электронный учебно-методический комплекс Риторика (Риторика)
650043, г. Кемерово, ул. Красная, 6. Тел. : (3842) 58-00-31. E-mail: poddub@gmail.com. Начальник научно-инновационного управления Поддубиков Владимир Валерьевич
 725.  Автомобильное колесо с безвоздушной шиной
Автомобильное колесо с безвоздушной шиной относится к области транспортного машиностроения. Автомобильное колесо с безвоздушной шиной представляет собой неразборную конструкцию и состоит из металлического колеса 1 и шины с упругими деформируемыми спицами, изготовленной из полимерного эластичного материала. Элементами безвоздушной шины являются внутреннее 2 и наружное 3 кольца, соединенные радиально расположенными упругими деформируемыми спицами 4 зигзагообразной формы, которая образована соединенными между собой дугообразными пластинами 5, 6, 7 и 8. Основную вертикальную нагрузку на колесо со стороны опорной поверхности воспринимает наружное кольцо 3, высокая радиальная жесткость которого обеспечивается расположенным внутри кольцом из эластичного полимера высокой твердости, что защищает безвоздушную шину от сквозных механических повреждений. Для уменьшения вибрации и шума при качении колеса упругие спицы соединены в окружном направлении перемычками 9, 10 и 11, которые могут быть как прямыми, так и иметь дугообразную форму. Технический результат - обеспечение неизменности характеристики радиальной жесткости безвоздушной шины по периметру беговой дорожки, уменьшение вибрации и шума при качении колеса, повышение прочности и надежности колесного движителя.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО Братский государственный университет, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 726.  Способ согласования четырехпроводной несиметричной линии электропередачи с электрической нагрузкой
Изобретение относится к электротехнике и может быть использовано при передаче электрической энергии потребителю с помощью несимметричной однородной линии электропередачи четырехпроводного исполнения входящей в состав несимметричной электроэнергетической системы. Согласование четырехпроводной линии электропередачи с электрической нагрузкой достигается в результате выполнения определенных условий, заключающихся в сопоставлении действительного и эталонного сопротивлений нагрузки, напряжений в конце линии или токов, поступающих в нагрузку. В результате обработки исходных данных в процессоре формируются управляющие сигналы для корректирующих органов, в качестве которых могут быть использованы устройства РПН силовых трансформаторов, реакторы и трехфазные или однофазные устройства, генерирующие ток и напряжение, такие как конденсаторные батареи, трехпроводная (без четвертого проводника от нейтрали источника питания и нагрузки) обобщенная нагрузка, имеющая в своем составе понижающий трансформатор, схема соединения первичной и вторичной обмотки которого звезда/ звезда с выведенным нулевым проводом или треугольник/ звезда с выведенным нулевым проводом. Технический результат - уменьшение потерь энергии и степени искажения кривых напряжения и тока.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО Братский государственный университет, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 727.  Дисковый рабочий орган бетоноотделочной машины с изменяемым градиентом СВЧ излучения
Изобретение относится к области строительной индустрии и может быть использовано для качественной обработки незатвердевших поверхностей железобетонных изделий, отформованных из жестких бетонных смесей для гражданского и промышленного строительства. Дисковый рабочий орган бетоноотделочной машины содержит приводной вал, который имеет возможность передавать крутящий момент на заглаживающий диск, причем в углублениях заглаживающего диска расположены магнетроны, создающие СВЧ-излучение, электропитание на которые подается посредством скользящих контактов через реостат, с помощью которого имеется возможность регулировать градиент СВЧ-излучения. Технический результат - получение высокого качества обработки поверхности бетонных изделий, получение высокопрочного поверхностного слоя.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО Братский государственный университет, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 728.  Способ сооружения защитных водоподпорных дамб
Описание способа сооружения защитных водоподпорных дамб
Миронов Виктор Владимирович
 729.  Способ повышения несущей способности и устойчивости фундаментов на слабых водонасыщенных основаниях
Описание способа повышения несущей способности и устойчивости фундаментов на слабых водонасыщенных основаниях
Бай Владимир Фёдорович
 730.  Способ повышения несущей способности фундаментов на слабых водонасыщенных основаниях
Описание способа повышения несущей способности фундаментов на слабых водонасыщенных основаниях
Бай Владимир Фёдорович
 731.  Способ герметизации межтрубного пространства трубопроводов типа труба в трубе
Описание способа герметизации межтрубного пространства трубопроводов типа труба в трубе
Миронов Виктор Владимирович
 732.  Способ сепарации нефтесодержащих эмульсий и временного хранения жидких углеводородов
Описание способа сепарации нефтесодержащих эмульсий и временного хранения жидких углеводородов
Миронов Виктор Владимирович
 733.  Способ измерения давления в поровой воде слабых водонасыщенных грунтов
Описание способа измерения давления в поровой воде слабых водонасыщенных грунтов
Пронозин Яков Александрович
 734.  Свайно-оболочечный фундамент
Технология производства свайно-оболочечного фундамента
Тер-Мартиросян Завен Григорьевич
 735.  Способ усиления ленточных фундаментов мелкого заложения
Описание способа усиления ленточных фундаментов мелкого заложения
Пронозин Яков Александрович
 736.  Армированная песчаная свая
Технология производства армированной песчаной сваи
Бай Владимир Федорович
 737.  Способ получения сложного оксида иттрия, бария и меди
Описание способа получения сложного оксида иттрия, бария и меди
Пимнева Людмила Анатольевна
 738.  Композиция для устройства оснований дорожных одежд и других сооружений
Композиция для устройства оснований дорожных одежд и других сооружений
Митрофанов Николай Георгиевич
 739.  Сырьевая смесь для изготовления керамзита
Технология производства сырьевой смеси для изготовления керамзита
Митрофанов Николай Георгиевич
 740.  Устройство для генерирования тепловой и электрической энергии
Технология для генерирования тепловой и электрической энергии
Миронов Виктор Владимирович
 741.  Армированная песчаная подушка с криволинейной подошвой
Технология получения армированной песчаной подушки с криволинейной подошвой
Бай Владимир Федорович
 742.  Способ изготовления буроинъекционной сваи с контролируемым уширением
Способ изготовления буроинъекционной сваи с контролируемым уширением
Пронозин Яков Александрович
 743.  Спиралевидный витой анкер
Технология производства спиралевидного витого анкера
Пронозин Яков Александрович
 744.  Программа SPORTAGE для учёта спортивных показателей вуза
Компьютерная программа для учёта спортивных показателей вуза
Наурусова Гульнара Ахмановна
 745.  Сырьевая смесь для производства грубой строительной керамики
Технология изготовления сырьевой смеси для производства грубой строительной керамики
Горгодзе Георгий Автандилович
 746.  Устройства для отбора образцов донных отложений
Отбор образцов донных отложений на глубинах, недоступных для шестовых грунтозаборников (от 6 до 30м) Стабильная, надежная работа, не происходит выпадения или вытекания образцов при подъеме с глубины Принцип работы устройства, тип 1 (глубина от 6 до 30м): производится взвод механизма поджима клапана и его установка на грунтозаборник. На петле грунтозаборника закрепляется фал. В вертикальном положении устройство сбрасывается в воду и под действием собственного веса погружается в донные отложения. После набора грунта оператор вытягивает устройство за фал, что приводит к расцеплению фиксаторов и уплотнению клапана. После этого грунтозаборник извлекается из грунта и доставляется на поверхность. Принцип работы поршневого устройства, тип 2 (глубина до 8м): поршень грунтозаборника взводится в крайнее положение и ставится в стопор. Стопор управляется при помощи фала. На конец поршневого грунтозаборника устанавливается набор штанг в соответствии с глубиной погружения. Грунтозаборник опускается в воду и вдавливается в грунт оператором. После этого при помощи фала поршень освобождается от стопора и путем опускания поршня удаляется столб воды над грунтом (через клапан), затем грунтозаборник извлекается и доставляется на поверхность.
Автор разработки: заведующий лабораторией кафедры гидротехнических сооружений Жданов В. А.
 747.  Комплексная ресурсосберегающая автоматизированная технология очистки промышленных сточных вод
Очистка высококонцентрированных стоков предприятий пищевой и текстильной промышленности до показателей технической воды Утилизация биогаза Получение почвоулучшающей композиции (удобрения) из избыточного активного ила Автоматизированная система контроля и управления установкой
член-корреспондент РААСН, доктор техн. наук, проф. Губанов Л. Н. , канд. техн. наук, доц. Катраева И. В.
 748.  Способ отбора бетонных образцов из монолитных строительных конструкций
Получение контрольных образцов-кубов, наиболее точно повторяющие характеристики бетона монолитной конструкции (образец формуют, уплотняют и выдерживают совместно с основной бетонной конструкцией) Сокращение трудоемкости, материальных затрат и сроков выполнения работ по установке форм, изъятию образцов и устранению образовавшихся дефектов Исключается повреждение образца в момент изъятия Многократное использование формы для контроля прочности монолитного бетона при строительстве зданий
канд. техн. наук, доц. Яворский А. А. , канд. техн. наук, доц. Сенников О. Е.
 749.  Автоматизированная технология тепловой обработки бетона для монолитного строительства
Повышение производительности труда в 5-10 раз Сокращение сроков строительства за счет интенсификации набора прочности бетоном при тепловой обработке в 2, 5-4 раза Снижение стоимости строительства объектов на 15-20% Повышение качества строительства Переход на круглогодичный производственный цикл монолитного строительства
канд. техн. наук, доц. Плотников Н. М. , канд. техн. наук, доц. Киргизов А. М.
 750.  Способ очистки продуктов сгорания газообразного топлива от токсичных веществ
Полнота сгорания топлива в широком диапазоне нагрузок и коэффициента избытка воздуха Снижение выбросов оксидов азота на 60-90% и продуктов неполного сгорания (оксида углерода, бензапирена)на 99-100% Способствуют полноте дожигания при пониженных нагрузках и пуске котла
канд. техн. наук, доц. Лебедева Е. А. , доц. Гордеев А. В.
 751.  Математические методы теории устойчивости и теории управления динамическими системами
Разработка и математическое моделирование нового типа автоматических регуляторов (так называемых робастных регуляторов) для динамических объектов разнообразной природы, гарантирующих устойчивость, оптимальность переходных процессов и заданный уровень гашения внешних возмущений в условиях неполной априорной информации Компьютерное моделирование динамики управляемых систем Разработка систем бесконтактного подвеса элементов конструкции в прецизионном приборостроении, машиностроении и на транспорте Разработка магнитореологических составов для активных систем гашения
доктор физ. -мат. наук, проф. Коган М. М.
 752.  Комплекс технологий по получению вяжущих веществ на основе доломита
Снижение себестоимости портландцемента на 20-30%, а извести-на 30-40% за счет использования местного сырья Снижение энергозатрат на производство-обжиг производится при более низких температурах по сравнению с аналогами-повышение КАЧЕСТВА строительных изделий Весомый вклад в реализацию национального проекта Доступное и комфортное жилье
доктор хим. наук, проф. Борисов А. Ф.
 753.  Технология получения высокопрочного гипсового вяжущего вещества (от Г-15 до Г-40)
Себестоимость вяжущего ниже на 30-50% по сравнению с аналогом за счет использования низкосортных гипсосодержащих пород в качестве сырья Снижение энергозатрат на производство вяжущего (не требует обжиг) Получение гипсового вяжущего с заданной маркой по прочности: может регулироваться от Г-15 до Г-40 Утилизация отходов добычи гипсового камня, что позволяет улучшить экологическую обстановку на карьерах
канд. техн. наук, доц. Веселов А. В.
 754.  Технология получения теплоизоляционного пенополеуретана пониженной пожарной опасности
Пониженная пожарная опасность материала: пониженные горючесть и воспламеняемость, относительно невысокая дымообразующая способность, самозатухание Повышенная теплостойкость материала (до 200° С) Повышенные эксплуатационные характеристики: повышенный предел прочности при сжатии, повышенная водостойкость, пониженное водопоглощение Снижение энергозатрат на производство-не требуется тепловая обработка
канд. техн. наук, проф. Сучков В. П.
 755.  Технология получения гипсового вяжущего вещества на основе шлама химоводоподготовки ТЭЦ
Себестоимость вяжущего ниже на 30-50% по сравнению с аналогом Снижение энергозатрат на производство вяжущего-не требует обжиг Получение гипсового вяжущего с заданной маркой по прочности: может регулироваться от Г-2 до Г-7. Утилизация шлама химоводоподготовки, что позволяет улучшить экологическую обстановку на ТЭЦ
канд. техн. наук, профессор Сучков В. П.
 756.  Технология обезвреживания иловых осадков городских сточных вод
Детоксикация и обеззараживание осадков городских сточных вод аминокислотными композициями Получение удобрения для сельского и городского хозяйства, для рекультивации нарушенных земель и свалок Низкая себестоимость удобрения: 50-300 руб. / т (для малых населенных пунктов с низкой концентрацией тяжелых металлов в исходном осадке). Стоимость аналогов: 3000-7000 руб. / т Возможность внедрения на существующих станциях аэрации
д-р техн. наук, профессор Губанов Л. Н.
 757.  Гидроцилиндр
Изобретение относится к объемным гидродвигателям, предназначенным для преобразования энергии потока рабочей жидкости в механическую энергию выходного звена, движущегося возвратно-поступательно. Гидроцилиндр содержит корпус с элементами крепления, состоящий из передней со сменной направляющей втулкой и задней крышек, снабженных уплотнителями и элементами их крепления на корпусе, шток с закрепленным на нем поршнем с уплотнителями и прикрепленный к передней крышке корпуса сильфон, внутренняя полость которого соединена пневмопроводом с пружинным пневмоаккумулятором. Технический результат - повышение надежности и обеспечение работоспособности гидроцилиндра с сильфоном.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 758.  Способ прогнозирования распределения гармонических составляющих тока и напряжения по неразветвлённым участкам шестипроводной линии электропередачи
Использование: в области электротехники. Технический результат - обеспечение возможности прогнозирования распределения гармонических составляющих тока и напряжения по неразветвленным участкам шестипроводных линий электропередачи. Согласно способу исследуемую неразветвленную часть шестипроводной линии электропередачи разбивают на однородные участки, определяют спектральные составы напряжения и тока в какой-либо точке исследуемого участка, а также определяют место нахождения источников каждой гармонической составляющей электрической энергии
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 759.  Способ определения краевого угла смачивания хвои предварительно обработанной водяным паром
Изобретение относится к области определения физико-химических свойств поверхностей и может быть использовано для оценки степени гидрофильности хвои, предварительно обработанной водяным паром. Изобретение решает задачу упрощения процесса определения краевого угла смачивания хвои, предварительно обработанной водяным паром. Технический результат заключается в повышении точности и простоты измерений величины краевого угла смачивания хвои, предварительно обработанной водяным паром.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 760.  Сырьевая смесь для изготовления стеновых керамических изделий
Изобретение предназначено для производства стеновых керамических изделий. Техническим результатом изобретения является повышение морозостойкости и снижение температуры обжига. Сырьевая смесь для изготовления стеновых керамических изделий включает пыль газоочистки производства ферросплавов с содержанием, мас. %: SiO2 - 61, 49-79, 58 и MgO - 1, 58-3, 57 и высококальциевую золу-унос от сжигания бурых углей при следующем соотношении компонентов, мас. %: пыль газоочистки производства ферросплавов - 35-55; зола-унос от сжигания бурых углей - 45-65.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 761.  Сырьевая смесь для изготовления керамических изделий
Изобретение предназначено для производства стеновых керамических изделий. Техническим результатом изобретения является повышение морозостойкости. Сырьевая смесь включает, мас. %: пыль газоочистки производства ферросплавов 63, 6 - 68, 6; закарбонизованный суглинок 27, 3 - 29, 4; минеральный шлам газоочистки рекультивируемого шламонакопителя производства алюминия 2, 0 - 9, 1. Морозостойкость смеси составляет 75 циклов. Обжиг полуфабриката производят при температуре 950оС.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 762.  Способ определения первичных параметров однородного участка трёхпроводной линии электропередачи
Изобретение относится к области систем обработки информации и может быть использовано при функциональном контроле и диагностировании трехфазных линий электропередачи (ЛЭП) трехпроводного исполнения на основе ее Г-образной схемы замещения полнофазного исполнения. Технический результат заключается в достоверном определении первичных параметров однородного участка трехпроводной линии электропередачи, а именно: активных сопротивлений и индуктивностей линейных проводов, активных проводимостей и емкостей между проводами, а также между проводами и землей.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 763.  Способ определения первичных и обобщённых вторичных параметров однородного участка трёхпроводной линии электропередачи методом восьмиполюсника
Изобретение относится к области систем обработки информации и может быть использовано при функциональном контроле и диагностировании трехфазных линий электропередачи (ЛЭП) трехпроводного исполнения на основании теории многополюсников. Технический результат заключается в достоверном определении первичных и обобщенных вторичных параметров однородного участка трехпроводной линии электропередачи, а именно: активных сопротивлений и индуктивностей линейных проводов, активных проводимостей и емкостей между проводами, а также между проводами и землей, в результате косвенных измерений входных и выходных фазных напряжений и линейных токов с последующим использованием теории восьмиполюсников.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 764.  Устройство для шлифования абразивными кругами
Изобретение относится к машиностроению и может быть использовано при электрохимической обработке деталей шлифовальными кругами. Способ включает вращение шлифовального круга и поступательное перемещение обрабатываемой заготовки. Шлифовальный круг жестко закрепляют между двумя дисками из токопроводящего материала, которые подключают к отрицательному полюсу источника постоянного электрического тока и устанавливают с зазором относительно поверхности обрабатываемой заготовки, подключенной к положительному источнику постоянного электрического тока. Посредством штуцера осуществляют подачу электролита в упомянутый зазор между дисками и обрабатываемой заготовкой для электрохимического разупрочнения материала на участке обрабатываемой заготовки с последующим его удалением шлифовальным кругом. Улучшается качество обработанной поверхности, снижается удельный расход абразива.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 765.  Сырьевая смесь для изготовления стеновых керамических изделий
Изобретение предназначено для производства стеновых керамических изделий. Техническим результатом изобретения является повышение прочности и морозостойки изделий. Сырьевая смесь для изготовления стеновых керамических изделий включает пыль газоочистки производства ферросплавов с содержанием, в мас. %: SiO2 - 61, 49-79, 58 и MgO - 1, 58-3, 57, закарбонизованный суглинок и высококальциевую золу-унос от сжигания бурых углей при следующем соотношении компонентов, в мас. %: пыль газоочистки производства ферросплавов - 66-68; зола-унос от сжигания бурых углей - 3-7; закарбонизованный суглинок - 27-29.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 766.  Способ определения укрупнённых вторичных параметров трёхпроводной линии электропередачи методом восьмиполюсника
Изобретение относится к области систем обработки информации и может быть использовано при функциональном контроле и диагностировании трехфазных линий электропередачи (ЛЭП) трехпроводного исполнения на основании теории многополюсников. Задачей изобретения является формирование простого, информативного и достоверного способа определения укрупненных вторичных параметров действующей трехфазной линии электропередачи трехпроводного исполнения, а именно: укрупненных постоянной распространения результирующей волны электромагнитного поля, коэффициентов затухания и фазы, собственных и взаимных волновых сопротивлений и фазовой скорости.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 767.  Способ согласования неоднородной четырёхпроводной несимметричной линии электропередачи с электрической нагрузкой
Изобретение относится к электротехнике и может быть использовано при проектировании, монтаже, наладке и эксплуатации четырехпроводных линий электропередачи (ЛЭП), при передаче электрической энергии по проводам ЛЭП от источника питания к потребителю. Задача изобретения - формирование способа согласования однородной несимметричной четырехпроводной ЛЭП с электрической нагрузкой. Технический результат заключается в обеспечении условий согласования однородной несимметричной четырехпроводной высоковольтной линии электропередачи с электрической нагрузкой, выполнение которых повлечет за собой уменьшение потерь электрической энергии, повышение пропускной способности линии, уменьшение степени искажения кривых напряжения и тока.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 768.  Сырьевая смесь для изготовления керамических изделий
Изобретение относится к составам сырьевых смесей, используемых для изготовления стеновых керамических изделий. Техническим результатом изобретения является снижение средней плотности, теплопроводности, воздушной усадки изделий и сокращение брака при сушке. Сырьевая смесь для изготовления стеновых керамических изделий включает закарбонизованный суглинок и водную суспензию, включающую гидратную известь, кислоты жирные талловые омыленные и соляную рапу, при следующем соотношении компонентов, мас. %: закарбонизованный суглинок - 88, 55-93, 45; гидратная известь - 3, 5-6, 5; кислоты жирные талловые омыленные - 1, 25-2, 75; соляная рапа - 1, 8-2, 2.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 769.  Сырьевая смесь для изготовления керамических изделий
Изобретение предназначено для производства стеновых керамических изделий. Техническим результатом изобретения является повышение морозостойкости при снижении средней плотности и теплопроводности. Сырьевая смесь включает, мас. %: пыль газоочистки производства ферросплавов 68, 0-66, 7; закарбонизованный суглинок 29, 1-28, 6; просыпь от дробления угольной футеровки 2, 9-4, 7. Морозостойкость составляет 75 циклов.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 770.  Сырьевая смесь для изготовления лёгкого заполнителя
Изобретение относится к производству строительных материалов, в частности к изготовлению легких заполнителей. Технический результат заключается в повышении морозостойкости и снижении водопоглощения заполнителя. Сырьевая смесь содержит следующие компоненты, мас. %: пыль газоочистки производства ферросплавов (ПГПФ) 63, 6-65, 6; водный раствор гидроксида натрия (концентрация 50%) 21, 3; жидкое стекло 10, 6; зола-унос 2, 3-4, 3; кислоты жирные таловые омыленные (КЖТО) 0, 2.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 771.  Сырьевая смесь для изготовления керамических изделий
Изобретение относится к составам сырьевых смесей, используемых для изготовления стеновых керамических изделий. Техническим результатом изобретения является снижение средней плотности, теплопроводности и воздушной усадки изделий. Сырьевая смесь для изготовления стеновых керамических изделий включает закарбонизованный суглинок и жидкость затворения в виде водной суспензии, включающей гидратную известь, кислоты жирные талловые омыленные и соляную рапу, при следующем соотношении компонентов, мас. %: закарбонизованный суглинок - 93, 45-88, 55; гидратная известь - 3, 5-6, 5; кислоты жирные талловые омыленные - 1, 25-2, 75; соляная рапа - 1, 8-2, 2.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 772.  Сырьевая смесь для изготовления стеновых керамических материалов
Изобретение относится к составам сырьевых смесей для производства керамических стеновых изделий. Техническим результатом изобретения является снижение средней плотности, повышение морозостойкости. Сырьевая смесь для изготовления стеновых керамических материалов включает пыль газоочистки производства ферросплавов (ПГПФ), золу-унос и водный раствор жидкого стекла с добавлением кислот талловых омыленных при следующем соотношении компонентов, мас. %: ПГПФ - 69, 4-71, 4; зола-унос - 22, 5-24, 5; жидкое стекло - 4, 7-4, 9; кислоты жидкие талловые омыленные - 1, 2-1, 4.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 773.  Способ определения укрупнённых первичных параметров трёхпроводной линии электропередачи
Изобретение относится к области систем обработки информации и может быть использовано при функциональном контроле и диагностировании трехфазных линий электропередачи (ЛЭП) трехпроводного исполнения на основе ее Г-образной схемы замещения полнофазного исполнения. Способ заключается в замещении всей трехпроводной линии электропередачи, включающей в свой состав несколько однородных участков, опоры, линейную арматуру и прочие сопутствующие устройства. Экспериментально определяют изображения действующих значений входных и выходных фазных напряжений и токов на комплексной плоскости и в последующем вычислении первичных параметров однородного участка трехпроводной линии электропередачи. Входные и выходные напряжения и токи определяются из серии экспериментов из четырех опытов и являются исходными данными для вычисления укрупненных активных сопротивлений и индуктивностей линейных проводов, укрупненных активных проводимостей и емкостей между проводами, а также между проводами и землей. Технический результат заключается в повышении точности определения параметров линии электропередачи.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 774.  Сырьевая смесь для изготовления керамических изделий
Изобретение относится к составам сырьевых смесей, используемых для изготовления стеновых керамических изделий. Техническим результатом изобретения является снижение средней плотности, теплопроводности, воздушной усадки изделий и сокращение брака при сушке. Сырьевая смесь для изготовления стеновых керамических изделий включает закарбонизованный суглинок и водную суспензию, включающую гидратную известь, пыль газоочистки производства ферросплавов, кислоты жирные талловые омыленные и соляную рапу, при следующем соотношении компонентов, мас. %: закарбонизованный суглинок - 84, 0-91, 7; гидратная известь - 5, 0-7, 0; пыль газоочистки ферросплавов - 1, 0-5, 0; кислоты жирные талловые омыленные - 1, 8-2, 5; соляная рапа - 1, 8-1, 5.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 775.  Композиция для производства древесностружечных плит
Изобретение относится к деревообрабатывающей промышленности и может быть использовано при производстве древесностружечных плит. В составе композиции для внутреннего слоя используется 10-40% стружки из отходов гниющих заготовок и 20% стружки из отходов оцилиндровки круглых лесоматериалов, а также 40-70 мас. % стружки, полученной из технологической щепы марки ПС, с применением связующего на основе низкомольной карбамидоформальдегидной смолы и эмульсии. При этом связующее состоит из низкомольной карбамидоформальдегидной смолы 60-62%-ной концентрации и водного раствора хлористого аммония 20%-ной концентрации. Эмульсия состоит из следующих компонентов, мас. %: парафин - 21, буроугольный воск - 14, эмульгатор - 1, вода - 64. Результатом является снижение материалоемкости производства древесностружечных плит, энергоемкости процесса прессования, повышение производительности прессового оборудования и снижение токсичности, а также получение плит, соответствующих требованиям ГОСТ 10632-2007 для марки П-А.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 776.  Вибрационный смеситель
Изобретение относится к устройствам для перемешивания бетонной смеси и может быть использовано в других областях строительной индустрии для производства многокомпонентных смесей. Технический результат - интенсификация процесса перемешивания компонентов в целом.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 777.  Виброизолятор для транспортно-технологических машин
Изобретение относится к области транспортного машиностроения. Виброизолятор состоит из массива резины, имеющего тороидальную форму. Резиновый массив имеет внутри две герметичные полости, в одной из которых установлена металлическая цилиндрическая пружина. Массив резины привулканизирован к крепежным пластинам. Достигается постоянство жесткостных и демпфирующих характеристик для различных частот воздействия и при установке агрегатов различной массы.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 778.  Гравитационный смеситель
Гравитационный смеситель, содержащий вращающийся барабан с лопастями и приводом вращения, установленный в опоре, внутри барабана консольно расположен вибратор с кинематическим возбуждением колебаний и приводом вращения, вибратор выполнен с корпусом, установленным на коленчатом валу так, что его продольная ось составляет с осью барабана 5-10° , один конец корпуса соосно соединен с дном барабана с помощью упругого элемента, а второй опирается посредством сферического подшипника на шатунную опору коленчатого вала, на котором размещен дисбаланс, выполненный с функцией динамической балансировки неуравновешенных масс, отличающийся тем, что корпус выполнен в виде металлического тонкостенного усеченного эллипса, на поверхности которого закреплены не менее четырех ребер жесткости, функцией которых является создание дополнительных интенсифицирующих воздействий на смешиваемые материалы.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 779.  Валочно-пакетирующая трелёвочная машина с трехопорной выравнивающейся платыормой и кабиной улучшенного обзора оператора
Валочно-пакетирующая трелевочная машина с трехопорной выравнивающейся платформой, состоящая из универсального шасси, опорно-поворотного устройства, поворотной платформы, стрелы, рукояти с захватно-срезающим устройством, коникового устройства, отличающаяся тем, что кабина установлена на поворотную платформу.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 780.  Абразивный круг для электрохимического шлифования с параллельным расположением токопроводящих вставок
Полезная модель относится к области металлообработки и может быть использована на технологических операциях электрохимического шлифования. Технический результат - увеличение производительности обработки шлифованием, улучшение качества обработанной поверхности и снижение удельного расхода абразива.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 781.  Фарвадер с сеткой для сбора древесных отходов
Полезная модель относится к лесной промышленности, позволяет осуществлять сбор древесных отходов с учетом дальнейшей их переработки, может применяться в условии лесосеки и лесного склада. Технический результат заключается в возможности и увеличение объема сбора древесных отходов, съемная сетка позволяет применить форвардер на отчистке лесосеки и лесного склада от отходов.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 782.  Фарвадер с устройством для уплотнения древесных отходов
Полезная модель относится к лесной промышленности, позволяет осуществлять сбор древесных отходов, может применяться в условии лесосеки и лесного склада. Технический результат заключается в том, что появляется возможность уплотнения древесных отходов, устройство может легко устанавливаться и демонтироваться в условиях лесосеки и лесного склада.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 783.  Абразивный круг для электрохимического шлифования с косым расположением токопроводящих вставок
Полезная модель относится к области металлообработки и может быть использована на технологических операциях электрохимического шлифования. Технический результат - увеличение производительности обработки шлифованием, улучшение качества обработанной поверхности и снижение удельного расхода абразива.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 784.  Абразивный круг для электрохимического шлифования с перпендикулярным расположением токопроводящих вставок
Полезная модель относится к области металлообработки и может быть использована на технологических операциях электрохимического шлифования. Технический результат - увеличение производительности обработки шлифованием, улучшение качества обработанной поверхности и снижение удельного расхода абразива.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 785.  Кусторез для содействия лесовозобновлению с опрыскивателем
Полезная модель относится к лесной промышленности и лесному хозяйству, предназначена для содействия естественному, искусственному возобновлению леса и обработки пестицидами и инсектицидами, а также подкормки минералами и удобрениями кустарниковой растительности, деревьев. Технический результат заключается в возможности обработки пестицидами и подкормки растительности сразу в ходе работы кустореза и многофункциональности применения кустореза.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 786.  Многочастотный вибросмеситель
(21), (22) Заявка: 2013149263/ 05, 05. 11. 2013 (24) Дата начала отсчета срока действия патента: 05. 11. 2013 Приоритет(ы): (22) Дата подачи заявки: 05. 11. 2013 (45) Опубликовано: 27. 06. 2014 Адрес для переписки: 665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, патентный отдел, Кварацхелия С. В. (72) Автор(ы): Ефремов Игорь Михайлович (RU), Багаудинов Игорь Борисович (RU), Соколов Александр Павлович (RU), Лобанов Дмитрий Викторович (RU) (73) Патентообладатель(и): Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Братский государственный университет (RU) (54) МНОГОЧАСТОТНЫЙ ВИБРОСМЕСИТЕЛЬ (57) Реферат: Полезная модель относится к устройствам для перемешивания бетонной смеси и может быть использована в промышленности строительных материалов, в строительстве и других областях строительной индустрии для производства многокомпонентных смесей. Технический результат заключается в расширении арсенала технических средств и обеспечении достижения новых свойств заявляемым объектам. То есть обеспечивается реализация возможности создания многочастотного вибрационного поля, за счет установки дополнительных сильфонов.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 787.  Измеритель мгновенного расхода топлива инжекторного двигателя внутреннего сгорания
Полезная модель относится к устройствам, позволяющим иметь бортовой прибор, который можно использовать как для контроля, так и для диагностики системы питания инжекторного двигателя внутреннего сгорания. Технически результат заключается в фильтрации, интегрировании, усилении напряжения, снимаемого с электромагнита форсунки. Далее этот сигнал умножается на тарировочную константу, вводимую с задатчика, превращается в цифровую форму и индицируется на цифровом индикаторе расхода.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 788.  Ультразвуковое устройство для поверхностной обработки природного и искусственного камня, содержащее динамический гаситель колебаний
Полезная модель используется в области строительной индустрии для высококачественной поверхностной обработки искусственного и природного камня, а также других хрупких и труднообрабатываемых материалов. Технический результат изобретения заключается в обеспечении высокого качества обработки поверхностей изделий из искусственного и природного камня, хрупких и труднообрабатываемых материалов, а также в увеличении производительности технологического процесса обработки вышеуказанных поверхностей. Технический результат достигается тем, что устройство закреплено на имеющей возможность передвижения по траверсе каретке и состоит из трех рабочих органов, которые упруго соединены с гасителем наведенных внешних вибраций и установлены симметрично по окружности так, что образуют тандем (балансиры) в поперечном к траверсе направлении.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 789.  Адаптивный виброизолятор
Изобретение относится к транспортному машиностроению. Виброизолятор состоит из полиуретанового массива, внутри которого выполнены кольцевые полости, представляющие собой камеры. Сверху и снизу к массиву крепятся металлические крепежные пластины. К нижней крепежной пластине с помощью резьбового соединения крепится монтажный штуцер, служащий для крепления адаптивного виброизолятора к несущей конструкции и подачи сжатого воздуха в центральную полость виброизолятора. Достигается обеспечение постоянной жесткости при установке агрегатов различной массы и возможность автоматически изменять жесткость в процессе работы
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 790.  Матрица для изготовления колёс
Изобретение относится к области транспортного машиностроения, в частности к производству полиуретановых автомобильных шин с упругими спицами. Технический результат заключается в снижении вероятности скопления инородных тел между спицами, в обеспечении возможности изготовления наружного кольца сложной формы, уменьшении трудоемкости извлечения готовой автомобильной шины без разрушения матрицы, а также повышении технологичности изготовления автомобильной шины из полиуретана методом литья.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 791.  Способ армирования автомобильных шин с упругими спицами и матрица для изготовления колес
Изобретение относиться к области транспортного машиностроения, в частности к производству шин из эластичных полиуретанов. Технический результат заключается в повышении качества армирования колес с шинами, изготавливаемыми из эластичных полиуретанов, уменьшении трудоемкости изготовления шин.
665709, Иркутская обл. , г. Братск, ул. Макаренко, 40, ФГБОУ ВПО БрГУ, проректор по инновационной деятельности Люблинский Валерий Аркадьевич, E-mail: id@brstu.ru
 792.  Способ контроля структурного совершенства монокристаллических полупроводниковых пластин
Способ контроля структурного совершенства монокристаллических полупроводниковых пластин использующий ионное облучение обратной стороны полупроводниковых структур, т. е. процедуру аналогичную ионно-лучевому геттерированию
Сергей Владимирович Оболенский, доктор технических наук, заведующий кафедрой электроники, www. rf. unn.ru/ eledep/ index. html заместитель декана радиофизического факультета по НИР, директор центра сетевой интеграции ННГУ им. Н. И. Лобачевского (Национальный исследовательский университет), г. Нижний Новгород, 603950, пр. Гагарина, 23, корп. 4, комн. 408 e-mail: obolensk@rf. unn.ru раб. 462-32-65, 462-32-66 моб. 8-952-472-19-46
 793.  Способ геттерирующей обработки эпитаксиальных слоев полупро-водниковых структур
Способ геттерирующей обработки эпитаксиальных слоев полупроводниковых структур улучшающий параметры полупроводниковых слоев и увеличивающий уровень радиационной стойкости
Сергей Владимирович Оболенский, доктор технических наук, заведующий кафедрой электроники, www. rf. unn.ru/ eledep/ index. html заместитель декана радиофизического факультета по НИР, директор центра сетевой интеграции ННГУ им. Н. И. Лобачевского (Национальный исследовательский университет), г. Нижний Новгород, 603950, пр. Гагарина, 23, корп. 4, комн. 408 e-mail: obolensk@rf. unn.ru раб. 462-32-65, 462-32-66 моб. 8-952-472-19-46
 794.  СПОСОБ ПОВЫШЕНИЯ ФУНКЦИОНАЛЬНЫХ ВОЗМОЖНОСТЕЙ ОРГАНИЗМА ЧЕЛОВЕКА С ПОМОЩЬЮ ПРЕ- И ПОСТКОНДИЦИОНИРОВАНИЯ
 795.  Фармакологические ингибиторы связанных со старением сигнальных путей
 796.  АНАЛИЗ АКТИВНОСТИ ГЕНОВ СТРЕСС-ОТВЕТА С ПОМОЩЬЮ МЕТОДА ОТ-ПЦР В РЕАЛЬНОМ ВРЕМЕНИ
 797.  Методика биотестирования проб экогенотоксикологической лабораторией СыктГУ
 798.  Способ получения нефтесорбентов
 799.  Рецептура формовочной массы для производства декоративных керамических изделий на основе природных глин г. Сыктывкара и г. Ухта
 800.  СПОСОБ ИЗГОТОВЛЕНИЯ ТИПОГРАФСКОЙ БУМАГИ
 801.  СПОСОБ ОПРЕДЕЛЕНИЯ КИСЛОРОДНОГО РЕЗЕРВА В ОРГАНИЗМЕ ЧЕЛОВЕКА ПУТЕМ ИЗМЕРЕНИЯ ПОТРЕБНОСТИ В КИСЛОРОДЕ
 802.  СПОСОБ ОПРЕДЕЛЕНИЯ ФУНКЦИОНАЛЬНЫХ РЕЗЕРВОВ ГЕМОДИНАМИКИ ЧЕЛОВЕКА ПУТЕМ ИЗМЕРЕНИЯ АРТЕРИАЛЬНОГО ДИАСТОЛИЧЕСКОГО ДАВЛЕНИЯ (АДД)
 803.  СПОСОБ ИССЛЕДОВАНИЯ РЕАКЦИИ ГОЛОВНОГО МОЗГА ЧЕЛОВЕКА НА ГИПОКСИЮ
 804.  Структурная неизотермическая математическая модель экструзии сжимаемого композитного материала
 805.  Характерные режимы твердофазной плунжерной экструзии вязкоупругого сжимаемого композитного материала
 806.  Объемное отверждение цилиндрического изделия в условиях термовязкоупругости при ненулевой критической глубине конверсионного поля
 807.  ПРОГРАММНАЯ РЕАЛИЗАЦИЯ АЛГОРИТМА ДВИЖЕНИЯ ПО ПАРАМЕТРУ ЖЕСТКОСТИ В ПРОБЛЕМЕ УСТОЙЧИВОСТИ НА ГРАНИЦЕ ВИНКЛЕРОВЫХ СРЕД
 808.  Расчет параметров напряженно-деформированного состояния круглой пластины по теории типа Кармана-Тимошенко-Нагди
 809.  Стационарное осесимметричное течение несжимаемой жидкости с постоянной вязкостью
 810.  Стационарное осесимметричное течение несжимаемой жидкости с переменной вязкостью
 811.  Бифуркационное исследование одномерного куэттовского течения псевдопластической жидкости в плоском зазоре в области сверханомалии
 812.  Программа расчета диссипативной структуры в области сверханомалии одномерного куэттовского течения псевдопластической жидкости в плоском зазоре
 813.  ФОРМИРОВАНИЕ СФЕРИЧЕСКОГО ИЗДЕЛИЯ С УЧЕТОМ НЕНУЛЕВОЙ КРИТИЧЕСКОЙ ГЛУБИНЫ КОНВЕРСИИ
 814.  Метод отображения параметра в задаче куэттовского течения псевдопластической жидкости в плоском зазоре
 815.  Куэттовское течение вязкой структурированной жидкости между двумя коаксиальными цилиндрами
 816.  Программная реализация комбинированного алгоритма перебора вариантов в задачах на собственные значения
 817.  Термовязкоупругое фронтальное отверждение сферического изделия с точки зрения непрерывно наращиваемого твердого тела с учетом давления перед фронтом отверждения
 818.  Структурная математическая модель экструзии пористого вязкоупругого материала на основе модели Максвелла с учетом влияния звуковой волны
 819.  Отверждение сферического изделия при нулевой критической глубине конверсии
 820.  Метод стрельбы нахождения стационарных решений в задаче куэттовского течения структурированной жидкости в плоском зазоре
 821.  Термовязкоупругое фронтальное отверждение цилиндрического изделия как непрерывно наращиваемого твердого тела с учетом давления перед фронтом отверждения
 822.  Локальная программа управления LPTDial
Инструмент для превращения научной лаборатории в единую сеть для проведения экспериментов, хранения и анализа их результатов, обмена научным опытом с другими лабораториями. Гибкость и модульность позволяют ей легко адаптироваться для решения похожих задач и в других областях
 823.  ИНДИВИДУАЛЬНЫЕ ПЛАНЫ
 824.  Вычислительный комплекс Твердофазная плунжерная экструзия вязкоупругого структурированного композитного материала
 825.  Информационная система автоматизации кадрового учета в учреждении высшего профессионального образования
 826.  Компьютерная диагностическая программа Мотивация научной деятельности студентов
 827.  ГИЗАУРУС (гипертекстовый тезаурус): автоматизированная гипертекстовая разметка текстов по лексикографической базе данных
 828.  Вычислительный комплекс Бифуркационный метод в нелинейных задачах механики
 829.  Программная система SQL-ТРЕНЕР: 1. 2
 830.  Mgml
 831.  Программа вычисления матричной экспоненты с применением симметрических многочленов
 832.  СИСТЕМА ЭЛЕКТРОННОГО ДОКУМЕНТООБОРОТА НА БАЗЕ ТЕХНОЛОГИИ MICROSOFT SHAREPOINT FOUNDATION 2010
 833.  Компьютерная диагностическая программа Кубики и цвет
 834.  Контроль температуры в автоматизированной лаборатории
 835.  Расчет круглой пластины с использованием web-технологий
 836.  Система управления сетью гостиниц PSHotel
 837.  Способ определения траектории движения автономного транспортного средства в динамической среде
Пантелеев М. Г. , Лебедев С. В.
 838.  Источник поверхностного излучения с управляемым спектром
Андреев С. В. , Беляев А. В. , Гуревич Б. С, Колесов И. А. , Челак В. Н. , Шаповалов В. В.
 839.  Способ оценки эффективности процесса разработки объектов военной техники
Описание методик оценки эффективности процесса разработки объектов военной техники
 840.  Способ обеспечения доступа к данным в системе управления базами данных Линтер-ВС
Система библиотек и API для обеспечения доступа к данным в системе управления базами данных Линтер-ВС
 841.  Способ обеспечения доступа к объектам в операционной системе МСВС
Система библиотек и API для обеспечения доступа к объектам в операционной системе МСВС
 842.  Расчет параметров захватных устройств для мешков различного типоразмера
Программа предназначен6а для расчета параметров рычажно-шарнирных захватных устройств (РШЗУ) для удержания мешков при наполнении их сыпучим материалом. Исходные данные для расчета служат линейные размеры мешка и тип сыпучего материала. Результатом вычислений является уравнение и график кривой провисания горловины приоткрытого мешка, а также некоторые рекомендуемые параметры РЗШУ и автоматической линии для расфасовки сыпучих материалов. Программа предназначена для практического использования на производстве при проектировании или выборе устройств для удержания мешков, а также автоматических линий наполнения мешков сыпучим материалом. Тип ЭВМ: Pentium IV. Язык: Delphi. OC: Windows XP.
 843.  Оптимизация сопряженной обработки партий деталей прецизионных пар
В программе осуществляется расчет оптимальных параметров размерной обработки более точно изготавливаемой детали соединения. Программа предназначена для практического использования при разработке технологии прецизионной сборки машино- и приборостроительных изделий и позволяет сократить количество недоукомплектованных изделий и минимизировать, тем самым, затраты на выполнение сборочного процесса. Тип ЭВМ: персональный IDM PC совместимый компьютер. Язык: Borland Developer Studio 2006 Professional OC: Windows XP.
 844.  Расчет предельного состояния сборных твердосплавных фрез
Программа предназначена для вычисления времени наступления предельного состояния сборного многолезвийного твердосплавного инструмента при обработке заготовок из углеродистых и легированных сталей и может применяться при составлении технологических процессов фрезерной обработки и для управления станочным оборудованием с ЧПУ. Программа обеспечивает вычисление интенсивности отказов твердосплавной пластины с наименьшими режущими свойствами; вычисление времени наступления предельного состояния сборной твердосплавной фрезы; вывод графика функции вероятности отказа инструмента с указанием момента времени наступления предельного состояния; сохранение исходных и расчетных данных в текстовый файл. Тип ЭВМ: Pentium IV. Язык: Delphi 7.
 845.  Синтез логической системы управления сортировкой плоских деталей различной конфигурации посредством контрольной маски
Программа предназначена для автоматизированного проектирования логических систем управления устройством, например, контрольной маской, для сортировки плоских соразмерных деталей по их конфигурации. Программа позволяет автоматически оптимизировать структуру маски по количеству контрольных датчиков и получать в минимизированном виде логические уравнения для построения одноконтактных систем автоматического управления сортировкой деталей. Тип ЭВМ: Pentium IV. Язык: Borland Developer Studio 2006 Professional. OC: Windows XP.
 846.  Программа синтеза цикловых логических систем автоматического управления технологическими процессами и оборудованием
Программа предназначена для автоматизированного проектирования цикловых систем различного технологического и вспомогательного оборудования. Она может быть использована для синтеза систем управления промышленными манипуляторами, робототехническими комплексами м металлообрабатывающим оборудованием. Программа позволяет автоматически получать в минимизированном виде управляющие логические уравнения для построения цикловых систем автоматического управления. Тип ЭВМ: Pentium IV. Язык: Borland Developer Studio 2006 Professional. OC: Windows XP.
 847.  Программа для расчета конструктивных и геометрических параметров раскатника центробежного типа для обработки полых валов поверхностным пластическим деформированием
Программа обеспечивает выполнения следующих функций: - выбор различного количества деформирующих элементов-роликов раскатного инструмента центробежного типа; - расчет конструктивных и геометрических параметров раскатного инструмента центробежного типа с учетом выбранного количества деформирующих элементов; - расчет необходимой частоты вращения инструмента для обеспечения требуемых параметров качества поверхностного слоя обрабатываемой детали; - подготовка специального файла расчетных данных для последующего построения параметрической модели раскатного инструмента центробежного типа. Тип ЭВМ: Desktop. Язык: Delphi. OC: Windows 2000, XP, Vista.
 848.  Программа для расчета на прочность соединений, собранных с натягом
Назначением данного программного обеспечения является расчет необходимых параметров, обеспечивающих условия прочности соединений, собранных с натягом. Особенностью данной программы является учет шероховатости контактирующих поверхностей при определении действительного натяга с использованием закономерностей, полученных для контакта единичных неровностей. Программа может быть применена для проектирования соединений с натягом в различных отраслях производства. Тип ЭВМ: IBM PC, совместимой комплектации. Язык: AcademicEdition NetWorked Volume Licenses Delphi 2007 Professional. OC: Windows 7 Professional.
 849.  Анализ изображений микроструктур феррито-перлитных сталей
Программа предназначена для проведения статистического анализа фотографий микроструктур сплавов с ячеистой структурой в автоматическом и ручном режимах в условиях низкого качества исходных изображений. Автоматический анализ серии или одиночных изображений микроструктур сплавов с разделением на светлые и темные элементы, построение гистограмм распределения структурных составляющих по размеру, построение гистограмм среднего размера зерен для серии изображений, задание области анализа. Предполагается использовать при проведении любых прикладных микроструктурных исследований сплавов (Промышленные лаборатории, техническая диагностика, пр. ). Тип ЭВМ: IBM PC, совместимой комплектации. Язык: C#. OC: MS Windows XP.
 850.  Автоматизированная система управления предприятием в кризисной обстановке
Автоматизированная система управления предприятием в кризисной обстановке предназначена для поддержки принятия решений в выборе стратегии выведения предприятия из кризиса. Автоматизированная система управления предприятия в кризисной обстановке позволяет автоматизировать процесс анализа финансовой устойчивости предприятия и процесс выбора стратегий выведения предприятия из кризиса. Программа обеспечивает выполнение следующих функций: - визуализация взаимосвязи и взаимодействия факторов предприятия; - автоматизация процессов введения бухгалтерских форм; - автоматизация процесса анализа бухгалтерских форм; - автоматизация процесса выбора стратегий выведения предприятия из кризиса; - автоматизация процесса формирования отчетов. Тип ЭВМ: IBM PC-совместимая ПК. Язык: - АВАР в среде SAP IDES ERP 6. 0 – Internet Demonstration and Educational System, - VBA в среде Microsoft Office Excel 2003. OC: Microsoft Windows XP Professional.
 851.  Автоматизированная система обучения диагностике и ремонту автомобиля с использованием средств виртуальной реальности и методов концептуального проектирования
Система предназначена для обучения человека устройству автомобиля, развития у него навыков диагностики и ремонта агрегатов транспортного средства, а также для стимулирования обучаемого к получению творческих решений при помощи методов концептуального проектирования. Программа обеспечивает выполнение следующих функций: - создание, хранение и управление списком изучаемых агрегатов; - составление, хранение и управление алгоритмами диагностики и ремонта агрегатов автомобиля; - ввод, изменение и вывод учебной информации об агрегатах; - отображение, перемещение, вращение, изменение масштаба обзора 3D моделей агрегатов; - видео-протоколирование действий обучаемого; - проверка знаний учащегося на основе решения им задач с помощью банка эвристических приемов; - расчет среднего ресурса тормозных накладок транспортного средства. Тип ЭВМ: IBM PC совместимый ПК. Язык: C# в среде Microsoft Visual Studio 2005. OC: Windows XP Professional.
 852.  Автоматизированная система выбора лекарственных средств
Программа предназначена для поддержки принятия решений в выборе лекарственных препаратов врачом на основе стратегического подхода, позволяет автоматизировать третий этап общего процесса лечения. Программа обеспечивает выполнение следующих функций: - визуалазация взаимосвязи и взаимодействия энергий органов человека; - автоматизация процесса поиска и выбора заболевания; - автоматизация процесса выбора эвристик лечебной коррекции больных органов; - автоматизация процесса формирования эвристик лечебной коррекции больных органов; - автоматизация процесса поиска лекарственных растений; - автоматизация процесса формирования отчетов. Тип ЭВМ: IBM PC совместимый ПК. Язык: C# в среде Microsoft Visual Studio 2005. OC: Windows XP Professional.
 853.  Программа мониторинга работы адаптивного регулятора
Программа предназначена для обеспечения мониторинга работы адаптивного алгоритма регулирования температуры объекта на базе микроконтроллеров серии РIC30/ 33. Область применения программы – энергоаудит, исследование систем климатического контроля, высокоточное регулирование (в т. ч. температуры). Программа обеспечивает выполнение следующих функций: - захват данных по шине RS-232; - создание файла данных о состоянии процесса регулирования; - управление системой адаптивного регулирования с помощью ПК. Тип ЭВМ: ЗС – совместимая, Intel Pentium III b выше. Язык: С# (C Sharp. ) OC: Microsoft Windows XP.
 854.  Программа для установления подлинности цифровых графических изображений
Программа предназначена для установления подлинности цифровых графических изображений png-формата и глубиной цвета 48 бит. Область применения программы – криминалистическая экспертиза. Программа обеспечивает выполнение следующих функций: - загрузка файла с автоматическим определением формата файла и глубины цвета изображения; - определение основных параметров изображения; - определение вероятности ошибки при применении разработанного метода к загруженному изображению; - вывод сообщения с результатом проведенного анализа. Тип ЭВМ: РС – совместимая Pentium III и выше. Язык: Visual C . OC: Windows XP.
 855.  Система моделирования динамики электронных потоков в скрещенных полях на вычислительном кластере центральных устройств (MDESonCluster CPUandGPU)
Программа представляет собой систему моделирования динамики электронных потоков в скрещенных электрическом и магнитном полях с различными параметрами. Данная система использует технологию вычислений на кластере Microsoft MPI и технологию вычислений на видеокартах NVIDIA CUDA для параллельного расчета динамики электронного потока. Программа обеспечивает выполнение следующих функций: - генерация электронов потока; - динамическое распределение нагрузки между узлами кластера; - пересылка информации об электронном потоке всем узлам кластера; - учет воздействия полей на электронный поток; - учет сил пространственного заряда; - сбор информации об электронном потоке от всех узлов кластера; - загрузка необходимых данных об электронном потоке из оперативной памяти компьютера в память видеокарты; - выгрузка необходимых данных об электронном потоке из памяти видеокарты в оперативную память компьютера. Тип ЭВС: Desktop PC, Portable Windows Devices. Язык: C . OC: Windows HPC Server 2008.
 856.  Программный комплекс тестирования знаний студентов Tester
Данная программа предназначена для оценки знаний студентов с помощью компьютерного тестирования, также может применяться для учета усвоения студентами пройденного материала. Программа обеспечивает выполнение следующих функций: - ввод личных данных тестируемого; - выбор случайным образом варианта вопроса из соответствующего блока базы теста; - удобное воспроизведение на экране иллюстрированного материала, формул в полях вопроса и вариантах ответа; - вывод результатов тестирования на экран; - печать результатов тестирования. Тип ЭВМ: IBM Visual Basic 6. 0. OC: Microsoft Windows 98/ Me/ 2000/ XP.
 857.  Расчет пределов изменения теплофизических характеристик огне-тепло-защитного вспучивающегося покрытия
Программа предназначена для расчета на тематических моделях пределов изменения теплофизических характеристик огнетеплозащитного покрытия при варьировании его физико-химических параметров. Программа применяется для выявления наиболее значимых факторов огнетеплозащитного вспучивающегося покрытия при различных режимах нагрева. Тип ЭВМ: IBM x86. Язык: QBASIC V. 1. 0. OC: Windows 9x, 2001, 2003, 2008.
 858.  Социологическое исследование с возможностью нанесения объектов на карту и анализ внесенных данных
Модуль автоматизированной системы социологического исследования с возможностью нанесения объектов на карту и анализ внесенных данных позволяет расширить исследовательский инструментарий социологов и маркетологов, включив в исследование топографические объекты. Модуль позволяет картографировать различные элементы среды проживания, с указанием ряда характеристик для каждого объекта. Это могут быть объекты (магазины, рынки, остановки транспорта, кафе, школы, клубы), а также события и явления (места совершения различных правонарушений, нелегальные точки торговли спиртным и наркотиками, проживание клиентов различных фирм, жителей пользующихся услугами различных городских служб). Достоинство программы: возможность использовать для работы любую карту города, района, области. Большинство из статистических программ имеют в своем арсенале ограниченные возможности работы с картами. Программа позволяет экспортировать данные в программы статистического анализа Excel, SPSS, Statistica. Тип ЭВМ: IBM PC не ниже Pentium II. Язык: CodeGear RAD STUDIO 2009. OC: Windows NT/ XP/ 2000/ Vista/ 7.
 859.  Автоматизированное рабочее место Бакалавр
Автоматизированное рабочее место Бакалавр обеспечивает хранение, накопление и представление всей необходимой информации о студентах-соискателях степени бакалавра по направлению 230100. 62 Информатика и вычислительная техника. АТМ Бакалавр предназначено для осуществления систематического контроля за ходом выполнения бакалаврских работ, в соответствии с разработанным выпускающей кафедрой планом и графиком. Постоянный мониторинг хода выполнения бакалаврских работ позволяет выявить отклонения на самых ранних стадиях выполнения. АРМ Бакалавр позволяет организовать оперативное и систематическое взаимодействие студентов с научными руководителями и обеспечивает формирование массива информации по текущему положению дел в области выполнения бакалаврских работ. Программный продукт содержит в себе базу данных, которая объединяет в себе все сведения необходимые для систематизации и упорядочения процесса работы по выполнению бакалаврской работы. Это позволяет в любой момент времени получить представление об объеме работ, выполненных любым студентом, так и всю картину в целом. Представляемый АРМ является открытой системой, допускающей добавление, обновление и модернизацию. Как отдельных модулей, так и всего программного комплекса. Это позволяет учитывать замечания ГАК и постоянно совершенствовать и повышать качество бакалаврских работ. Тип ЭВМ: IBM PC не ниже Pentium II. Язык: PHP, JavaScript, HTML, CSS, XML. Хостинг: Apache 2 с поддержкой MySQL 5 b PHP 5 . Браузер: Chrome 10 ? Firefox 3. 6, Opera 10 , IE 9 .
 860.  Расчет повреждаемости нитей на ткацком станке по критерию длительной прочности Москвитина на основе использования тригонометрического ряда Фурье
Предлагаемая программа расчета повреждаемости нитей на ткацком станке по критерию длительной прочности Москвитина на основе использования тригонометрического ряда Фурье позволяет прогнозировать натяжение нитей на ткацком оборудовании при осуществлении контроля обрывности нитей не текстильных предприятиях. Целью расчета повреждаемости нитей на ткацком станке по критерию длительной прочности Москвитина является оценка напряженности работы ткацкого станка. В качестве математических моделей технологического процесса ткачества используются математические модели, полученные при использовании метода приближения функций – тригонометрического ряда Фурье. Программа обеспечивает выполнение следующих функций: - получение математической модели натяжения нитей основы при использовании тригонометрического ряда Фурье; - определение погрешности полученной математической модели; - определение коэффициента повреждаемости нитей на ткацком станке. Тип ЭВМ: Pentium IV. Язык: MathCad. OC: Windows XP.
 861.  Расчет заработной платы оператора сновального оборудования
Предлагаемая программа автоматизированного расчета заработной платы оператора сновального оборудования позволяет в короткие сроки рассчитать заработную плату оператора сновального оборудования. Программа позволяет получить выходной документ, в котором содержатся размер сдельной и повременной части заработной платы оператора сновального оборудования, величина премии, доплат за работу в ночное время, в вечернее время, в воскресные дни. Причем все промежуточные варианты и необходимые численные данные хорошо визуализированы, то есть проектировщик в доступном виде на экране монитора видит весь алгоритм расчета в привычной форме записи. Тип ЭВМ: Pentium IV. Язык: MathCad. OC: Windows XP.
 862.  Анализ динамики и структуры бухгалтерского баланса и его ликвидности
Предлагаемая программа автоматизированного расчета показателей динамики и структуры бухгалтерского баланса и его ликвидности позволяет в короткие сроки рассчитать показатели динамики и структуры бухгалтерского баланса и оценить его ликвидность. Программа формирует выводы по итогам расчета: об абсолютном и относительном изменении показателей баланса; о структурных сдвигах в активе и пассиве баланса; о ликвидности баланса. Тип ЭВМ: Pentium IV. Язык: Microsoft Visual Basic Application. OC: Windows XP.
 863.  Расчет выбросов вредных веществ автотранспортом в атмосферу в районе регулируемого перекрестка автомагистрали
Программа предназначена для расчета оценочных объемов выбросов вредных веществ в атмосферу автотранспортными потоками в районе регулируемого перекрестка автомагистрали. Расчет выполняется в соответствии с утвержденной методикой определения выбросов от автотранспорта, разработанной в НИИ Атмосфера. Программа может быть использована для проведения исследований и расчетов степени загрязнения атмосферы города от автотранспорта. Программа обеспечивает выполнение следующих функций: - задание параметров регулируемого перекрестка; - расчет оценочных объемов выбросов вредных веществ в районе регулируемого перекрестка; - сравнение полученных объемов выбросов с предельно допустимыми концентрациями. Тип ЭВМ: IBM PC совместимый. Язык: встроенный язык программирования в среде Mathcad. OC: Windows XP. Объем: 155 Кб.
 864.  Поддержка нечеткого финансового анализа инвестиционных проектов
Программа предназначена для финансового анализа инвестиционных и инновационных проектов. Исходными данными для анализа является таблица денежных потоков по проекту. Особенность программы состоит в том, что любые типы исходных данных могут быть оценены нечетко, что позволяет вести анализ в условиях экономической неопределенности и с учетом этой неопределенности. Результатом работы программы являются величины ряда видов рисков (финансовый, кредитный, риск неокупаемости), которые выражают вероятность убыточности проекта при текущем уровне неопределенности и заданных границах размытости исходных данных. Программа предназначена для использования в процессе экономического анализа в условиях неопределенности. Что может быть полезно для среднесрочных и долгосрочных проектов, когда неопределенность предсказания будущего не может быть проигнорирована. Тип ЭВМ: IBM PC совместимые. Язык: Python. OC: Windows/ Linux/ MacOS. Объем: 11 Кб.
 865.  Программа управления электронным каталогом высокотехнологичного оборудования и объектов научного потенциала РФ
Web-клиент Интернет-ресурса, расположенного по адресу: www. каталог-нп. рф
т. (495) 411-99-12, Тыщенко Михаил Александрович - начальник отдела разработки СПО
 866.  База данных отраслевых показателей
 867.  Математическая модель широкозонного транзистора
 868.  TAVR-оптимизация присоединяемого таврового профиля
 869.  Программное обеспечение первой очереди многоуровневой защищенной телекоммуникационной сети судостроительной промышленности (МЗ ТКС)
 870.  Адаптивный клиентский пакет информационных услуг участника Единой информационной системы
 871.  База данных по компонентам и материалам для проектирования автомобилей по их полному жизненному циклу (ПЖЦ)
 872.  Программа для ЭВМ по оценке продукции в полном жизненном цикле (ПЖЦ)
 873.  Программное обеспечение по управлению беспилотным автотранспортным средством в режиме ручного управления
 874.  Моделирование автотранспортных средств с комбинированными энергетическими установками
 875.  Программное обеспечение преобразователя ACI-Control
 876.  Программа расчета токов короткого замыкания в судовой электроэнергетической системе (1-КS)
 877.  Программа для ЭВМ по измерению геометрических и весовых праметров ледяных наростов на врвщающихся частях двигателя.
 878.  Автоматизированная информационная система обеспечения управления деятельностью Минпромторга России в сфере государственного оборонного заказа и закрытых федеральных целевых программ
 879.  Программа обработки аналоговых сигналов
 880.  Программа расчета параметров судового синхронного генератора
 881.  Имитатор для тестирования программного обеспечения систем управления судовым электродвижением
 882.  Программа определения частотных характеристик испытуемых рулевых приводов на стенде нагрузочных испытательных машин
 883.  Программа определения динамической жесткости испытуемых рулевых приводов на стенде нагрузочных испытательных машин
 884.  Программа визуализации результатов многоканальной системы сбора данных экспериментальных исследований в аэродинамической трубе (Spektr10)
 885.  Программа определения расстояния между нулевым и ближайшим нулевым элементом двумерной матрицы для использования в математическом ядре системы автоматизированной разработки управляющих программ для оборудования с ЧПУ
 886.  Программа поиска точки на поверхности в параметрической форме, ближайшей к заданной точке
 887.  Программа расчета точек цилиндрической винтовой линии и представления в виде унифицированного В-сплайна и его частного вида - кривой Безье
 888.  Программа определения длины дуги по параметру t сплайна Bezier, заданного своим опорным каркасом
 889.  Программа расчета геометрии кинематической поверхности при плоско-параллельном движении образующей и представления её в виде составной поверхности Безье
 890.  Программная система для автоматизированной разработки управляющих программ для всех типов оборудования с числовым программным управлением, базирующейся на оригинальных отечественных программно-математических средствах
 891.  Программный модуль для анализа прочности и оценки устойчивости панели из композиционного материала
 892.  Программа послойного моделирования полимерных композиционных материалов в трёхмерной постановке
 893.  Программа расчета акустических характеристик НВ, обусловленных эффектом вытеснения
 894.  Программа расчета аэродинамических характеристик несущих винтов на режимах осевого обтекания
 895.  Типовой сетевой програрммный комплекс для управления руководителем контракта исполнителями работ
 896.  Программа для управления порталом для сбора и экспертизы заявок на НИР
 897.  Экспертиза НИР
 898.  Программа расчета траектории разгона аэрокосмического ЛА с ЖРД
 899.  Boom-Cfx
 900.  Программное обеспечение для обработки результатов калибровки многокомпонентных весов
 901.  Тексты программ, предназначенных для расчета многоствольных многолучевых усиленных клистронов и клистронов на резонаторах с распределенным взаимодействием
 902.  Программная документация комплекса численного моделирования устройств СВЧ техники
 903.  CALS-система многоаспектной экспресс-оценки текущего состояния ОПК, как базового аналитического комплекса для подготовки управленческих решений
 904.  Информация об аутентичных комплектующих изделиях для обеспечения возможности мониторинга состояния производственного цикла
 905.  Автоматизированная система сбора, анализа и учёта информации об обеспечении технологического процесса производства комплектующих авиационных двигателей
 906.  Электронная система информационного обеспечения (ЭСИО) данными отраслевого классификатора материалов судостроительной продукции
 907.  Централизованная база данных с использованием отраслевого классификатора материалов
 908.  Программное обеспечение базового модуля (сервера) для информационного обмена бортовой мультиплексной сети.
 909.  Программное диагностическое обеспечение модулей электропитания
 910.  Программа управления подводным модулем масс-спектрометрических и рентгенофлуоресцентных измерений (СТРАЖ-МСРФ)
 911.  Специальное программное обеспечение Программно-технического комплекса Информационно-аналитической подсистемы Интегрированной системы контроля аварийных ситуаций в районах освоения месторождений углеводородов на Арктическом шельфе с использованием автоматизированных стационарных и мобильных измерительных комплексов
 912.  База данных Программно-технического комплекса Информационно-аналитической подсистемы Интегрированной системы контроля аварийных ситуаций в районах освоения месторождений углеводородов на Арктическом шельфе с использованием автоматизированных стационарных и мобильных измерительных комплексов
 913.  Программа микропроцессорного управления для активной противокоррозионной защиты гребных винтов, гребных валов, подшипников скольжения
 914.  Программа локализации мест излучения квазигармонических акусических сигналов с целью выявления основных исочников повышенных уровней внешнего шума
 915.  Ямал-Логистика-программный комплекс для анализа и оптимизации проектных параметров судна и структуры логистической системы вывоза сжиженного природного газа из района полуострова Ямал
 916.  Программа моделирования аварийных ситуаций, связанных с возникновением пожара на объектах морской техники, предназначенная для функционирования на суперкомпьютере
 917.  Программа расчёта посадки судна для различных случаев задания весовой нагрузки
 918.  Программа диагностирования систем управления и защит ЕЭЭС во время их эксплуатации
 919.  Программа расчёта электромагнитных полей на судах
 920.  Программа расчёта уровней воздушного шума в судовых помещениях NAP
 921.  Программа расчёта перепадов на амортизирующих креплениях механизмов, SMI
 922.  Программа оценки динамических характеристик судна с обводами типа Моноклин
 923.  Программное обеспечение для сбора экспериментальных данных и дистанционного управления моделью судна методом физического моделирования в ледовом опытовом бассейне
 924.  Программное обеспечение обработки информации физического моделирования
 925.  Блок моделирования ледовой обстановки
 926.  Расчёт предельной ударостойкости элементов оборудования
 927.  Расчет статической и динамической устойчивости приспособления для установки ротора с постоянным магнитом в статор электродвигателя при доминирующей боковой силе тяжения
 928.  Программа построения расчётных сеток около движительных комплексов судов с учётом возможностей суперкомпьютеров
 929.  Программа для учёта правил IMO по определению конструктивного коэффициента энергоэффективности на различных стадиях проектирования судов
 930.  База данных по системам управления, навигации, связи, сбора и анализа информации, измерения параметров среды и освещения обстановки
 931.  Программа моделирования функционирования комплексов технических средств на объектах морской техники
 932.  Трубоукладочные суда (ТУС)
 933.  Компьютерная программа проектировочного расчета водометного движительного комплекса с двухступенчатой лопастной системой в насадке
 934.  Программа поверочного расчета водометного движительного комплекса с двухступенчатой лопастной системой в насадке
 935.  Первичная обработка измеренного вибрационного сигнала для его использования в целях вибродиагностики судового оборудования
 936.  Программа управления АЭ системой
 937.  Среда формирования каталогов CatalogOn
 938.  Электронный каталог камбузного и медицинского оборудования
 939.  База данных утвержденных наименований продукции судостроения на основе рабочей версии электронного открытого технического словаря (eOTD ECCMA)
 940.  Программа расчёта общих ледовых нагрузок и ускорений при работе набегами
 941.  Комплекс программных средств для сбора, анализа и ретрансляции NMEA-подобных данных, транслируемых в судовых информационных сетях
 942.  Прикладное программное обеспечение для проведения скоростных испытаний судов
 943.  Приём и протоколирование данных при измерении среднего крутящего момента, осевого упора и кинематических характеристик вращающихся валов
 944.  Обработка результатов измерений среднего крутящего момента, осевого упора и кинематических характеристик вращающихся валов
 945.  Серверное программное обеспечение интеграции, управления и хранения данных эксперимента в системе Мониторинг-супер
 946.  Библиотека подпрограмм передачи данных в системе Мониторинг-супер
 947.  Клиентское программное обеспечение подготовки и мониторинга эксперимента в системе Мониторинг-супер
 948.  Программа выявления скрытой периодичности в шуме и вибрации, создаваемых движителем, с применением полиспектрального анализа
 949.  Программное обеспечение рабочего места для обнаружения кавитационных явлений на основе математического анализа видеоряда
 950.  Оценка турбулентной составляющей помехи, обусловленной турбулентным потоком, обтекающим антенны гидроакустических средств
 951.  Оценка шумовой составляющей помехи, вызванной работой гребного винта
 952.  База данных моделей объектов тренажера Универсал
 953.  Программное обеспечение кранового оборудования тренажера
 954.  Индикатор ближней морской навигационной обстановки
 955.  Программа планирования и выполнения операций при решении задач прямой отгрузки нефти
 956.  Программа для отработки взаимодействия платформы с танкерами и обслуживающими судами при выполнении погрузочно-разгрузочных операций
 957.  База данных моделей объектов тренажера Взаимодействие
 958.  Программное обеспечение универсального адаптируемого (перенастраиваемого) тренажерного комплекса для операторов подводных аппаратов
 959.  База данных универсального адаптируемого (перенастраиваемого) тренажерного комплекса для операторов подводных аппаратов
 960.  Технологическая база данных для формирования информационного обеспечения, необходимого для выполнения формализованной оценки пожарной безопасности
 961.  Программа формализованной оценки пожарной безопасности объектов гражданской морской техники
 962.  Расчет несущей способности сферической оболочки с заданной вмятиной обшивки
 963.  Расчет местной несущей способности цилиндрической оболочки при наличии одиночной вмятины обшивки
 964.  Расчет местной несущей способности цилиндрической оболочки с учетом сочетания многоволновой регулярной и осесимметричной погиби
 965.  Программа расчета амортизирующих креплений судового оборудования и механизмов с учетом динамических свойств фундаментальных конструкций, CMSZ_CALC
 966.  Программа интерактивной подготовки исходных данных с учётом динамических свойств фундаментальных конструкций, запуска на счёт и просмотра результатов расчета, CMSZ
 967.  Специализированная программа расчета развития поверхностных дефектов типа трещин SemiEllips-PL
 968.  Физико-механические и экономические характеристики корпусных материалов и конструкции корпусов различного назначения
 969.  Программа расчета гидродинамических сил, действующих на плоский контур, который совершает вертикальные гармонические колебания на поверхности жидкости
 970.  Программа постороения расчетных сеток для корпусов водоизмещающих судов
 971.  Программа расчета спектра собственных частот и форм свободных колебаний протяженных элементов морских комплексов освоения шельфа - Free Oscillation
 972.  Программа расчета параметров вихревой вибрации протяженных элементов морских комплексов освоения шельфа - Vibration
 973.  Программа для численного прогнозирования волнового сопротивления многокорпусных судов
 974.  Программа расчета колебаний, гидродинамического шума и критерия оптимальности конструкций Interaction-CALC
 975.  Программа интерактивной подготовки исходных данных и просмотра результатов расчета Interaction-Edit View
 976.  Программа оптимизации профиля трехслойных панелей PANEL
 977.  Расчет геометрии гребных винтов регулируемого шага
 978.  Программа гидродинамического расчета осевых насосов водометных движителей
 979.  Компьютерная программа для использования данных серийных модельных испытаний гребных винтов фиксированного шага (ВФШ)
 980.  Компьютерная база данных для выбора и проектирования гребных винтов
 981.  База данных по гидродинамическим и маневренным характеристикам судов различных типов
 982.  Электронный реестр отраслевых органов по сертификации и испытательных лабораторий
 983.  Электронный реестр учета выданных сертификатов
 984.  База данных сертифицированных систем менеджмента качества предприятий и организций судостроения
 985.  База данных основных характеристик морских судов и объектов морской техники различных типов, предназначенная для использования в едином информационно-аналитическом комплексе
 986.  Программный модуль по определению предпожарных ситуаций на основе обработки данных от средств контроля среды и различных судовых систем
 987.  Программный модуль вычисления среднеобъемной температуры в помещении с использованием данных от двухканальной телевизионной камеры
 988.  Программный модуль обнаружения и вычисления параметров очага горения с использованием данных тепловизионного канала камеры
 989.  Программа для решения задач информационной поддержки по обеспечению пожаробезопасности и борьбы с пожаром на объектах морской техники
 990.  Оптимальное проектирование основных элементов прочных цилиндрических корпусов подводных нефте- и газохранилищ
 991.  База данных служб стандартизации предприятий судостроительной промышленности
 992.  Электронный фонд нормативных, технических и информационных документов судостроения
 993.  Программа расчета распротранения шума и вибраций в сложной акустомеханической структуре с учетом взаимного преобразования (StatmodV2)